Origin IGS:
tctatcgactccgaagcgcatcgcacggatatactgccgggaatgatcgggcttcctgtccgatcgaaaggaccggttttcaacggaagttgtatatatttgagcgctttgtttcagtacgattctccgccctcttattgcgatcggagggcggtgcaaaaaacgatccaatcaaacacatatattat
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
ataatatatgtgtttgattggatcgttttttgcaccgccctccgatcgcaataagagggcggagaatcgtactgaaacaaagcgctcaaatatatacaacttccgttgaaaaccggtcctttcgatcggacaggaagcccgatcattcccggcagtatatccgtgcgatgcgcttcggagtcgataga

Mask Tandem Repeat Region ================================================
tctatcgactccgaagcgcatcgcacggatatactgccgggaatgatcgggcttcctgtccgatcgaaaggaccggttttcaacggaagttgtatatatttgagcgctttgtttcagtacgattctccgccctcttattgcgatcggagggcggtgcaaaaaacgatccaatcaaacacatatattat

Find is-nt database================================================
Query_seq: PG0443:PG0444|PG0443:PG0444:hemagglutinin-related protein:oligopeptide transporter, OPT family:->->:483208..483395 188
tctatcgactccgaagcgcatcgcacggatatactgccgggaatgatcgggcttcctgtccgatcgaaaggaccggttttcaacggaagttgtatatatttgagcgctttgtttcagtacgattctccgccctcttattgcgatcggagggcggtgcaaaaaacgatccaatcaaacacatatattat
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PG0443:PG0444|PG0443:PG0444:hemagglutinin-related protein:oligopeptide transporter, OPT family:->->:483208..483395 188
tctatcgactccgaagcgcatcgcacggatatactgccgggaatgatcgggcttcctgtccgatcgaaaggaccggttttcaacggaagttgtatatatttgagcgctttgtttcagtacgattctccgccctcttattgcgatcggagggcggtgcaaaaaacgatccaatcaaacacatatattat
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PG0443:PG0444|PG0443:PG0444:hemagglutinin-related protein:oligopeptide transporter, OPT family:->->:483208..483395 188
tctatcgactccgaagcgcatcgcacggatatactgccgggaatgatcgggcttcctgtccgatcgaaaggaccggttttcaacggaagttgtatatatttgagcgctttgtttcagtacgattctccgccctcttattgcgatcggagggcggtgcaaaaaacgatccaatcaaacacatatattat
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tctatcgactccgaagcgcatcgcacggatatactgccgggaatgatcgggcttcctgtccgatcgaaaggaccggttttcaacggaagttgtatatatttgagcgctttgtttcagtacgattctccgccctcttattgcgatcggagggcggtgcaaaaaacgatccaatcaaacacatatattat
Predict ORF larger than 30AA ================================================
Protein_Len: 60	Strand: +	Start: 4	End: 186
... M  D  S  E  A  H  R  T  D  I  L  P  G  M  I  G  L  P  V  R  S  K  G  P  V  F  N  G  S  C  I  Y  L  S  A  L  F  Q  Y  D  S  P  P  S  Y  C  D  R  R  A  V  Q  K  T  I  Q  S  N  T  Y ..
Protein_Len: 42	Strand: +	Start: 63	End: 188
.............................................................. M  E  R  T  G  F  Q  R  K  L  Y  I  F  E  R  F  V  S  V  R  F  S  A  L  L  L  R  S  E  G  G  A  K  N  D  P  I  K  H  I  Y  Y 
Protein_Len: 33	Strand: -	Start: 83	End: 181
.................................................................................. R  F  N  Y  I  N  S  R  K  T  E  T  R  N  E  A  R  K  N  R  D  S  P  P  A  F  F  S  G  I  L  C  M .......
Protein_Len: 31	Strand: -	Start: 3	End: 95
.. I  S  E  S  A  C  R  V  S  I  S  G  P  I  I  P  S  G  T  R  D  F  P  G  T  K  L  P  L  Q  M .............................................................................................
Protein_Len: 57	Strand: -	Start: 1	End: 171
 R  D  V  G  F  R  M  A  R  I  Y  Q  R  S  H  D  P  K  R  D  S  R  F  S  R  N  E  V  S  T  T  Y  I  Q  A  S  Q  K  L  V  I  R  R  G  R  I  A  I  P  P  R  H  L  F  R  D  M .................

tctatcgactccgaagcgcatcgcacggatatactgccgggaatgatcgggcttcctgtccgatcgaaaggaccggttttcaacggaagttgtatatatttgagcgctttgtttcagtacgattctccgccctcttattgcgatcggagggcggtgcaaaaaacgatccaatcaaacacatatattat
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tctatcgactccgaagcgcatcgcacggatatactgccgggaatgatcgggcttcctgtccgatcgaaaggaccggttttcaacggaagttgtatatatttgagcgctttgtttcagtacgattctccgccctcttattgcgatcggagggcggtgcaaaaaacgatccaatcaaacacatatattat
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: PG0443:PG0444|PG0443:PG0444:hemagglutinin-related protein:oligopeptide transporter, OPT family:->->:483208..483395 188
tctatcgactccgaagcgcatcgcacggatatactgccgggaatgatcgggcttcctgtccgatcgaaaggaccggttttcaacggaagttgtatatatttgagcgctttgtttcagtacgattctccgccctcttattgcgatcggagggcggtgcaaaaaacgatccaatcaaacacatatattat
Intra-Species Hit: Count: 1	Min: 1	Max: 188	Len: 188
Subject: NC_002950_PG0443_PG0444|hemagglutinin-related protein:oligopeptide transporter, OPT family|POSITIVE:POSITIVE|[483208,483395]|188
HSP  1	e-value: 1.0E-102	bit: 373.0	Len: 188	Query Start:1	Query End:188	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 188
tctatcgactccgaagcgcatcgcacggatatactgccgggaatgatcgggcttcctgtccgatcgaaaggaccggttttcaacggaagttgtatatatttgagcgctttgtttcagtacgattctccgccctcttattgcgatcggagggcggtgcaaaaaacgatccaatcaaacacatatattat
tctatcgactccgaagcgcatcgcacggatatactgccgggaatgatcgggcttcctgtccgatcgaaaggaccggttttcaacggaagttgtatatatttgagcgctttgtttcagtacgattctccgccctcttattgcgatcggagggcggtgcaaaaaacgatccaatcaaacacatatattat

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UCUAUCGACUCCGAAGCGCAUCGCACGGAUAUACUGCCGGGAAUGAUCGGGCUUCCUGUCCGAUCGAAAGGACCGGUUUUCAACGGAAGUUGUAUAUAUUUGAGCGCUUUGUUUCAGUACGAUUCUCCGCCCUCUUAUUGCGAUCGGAGGGCGGUGCAAAAAACGAUCCAAUCAAACACAUAUAUUAU
...(((((((..((((((...(((.((((((((..(((((...(((((((((.....)))))))))......)))))...((((....))))..)))))))).)))...))))))))).))))...(((((((((.((....)).))))))))).................................. (-63.50)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AUAAUAUAUGUGUUUGAUUGGAUCGUUUUUUGCACCGCCCUCCGAUCGCAAUAAGAGGGCGGAGAAUCGUACUGAAACAAAGCGCUCAAAUAUAUACAACUUCCGUUGAAAACCGGUCCUUUCGAUCGGACAGGAAGCCCGAUCAUUCCCGGCAGUAUAUCCGUGCGAUGCGCUUCGGAGUCGAUAGA
......((((((((((((((..((((......(.((((((((..((....))..)))))))).)......)).))..))).....))))))))))).....((..((((...((((.......((((((.(.....).))))))....)))).......((((.(((...)))..)))).))))..)) (-51.80)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
456	57	12	194	138	NC_002950:PG0387|5end_elongation_factor_Tu_420643..420873_POSITIVE
418	67	21	200	144	NC_002950:PG1594|5end_ComEC/Rec2-related_protein_1673587..1673817_NEGATIVE
391	77	34	199	145	NC_002950:PG1348|5end_conserved_hypothetical_protein_TIGR00147_1428608..1428838_POSITIVE
383	156	111	162	113	NC_002950:PG1226|5end_peptidyl-prolyl_cis-trans_isomerase,_cyclophilin-type_1303264..1303494_POSITIVE
382	78	31	177	126	NC_002950:PG1310|5end_exsB_protein_1389084..1389314_POSITIVE
380	160	116	85	33	NC_002950:PG1356|5end_hypothetical_protein_1435849..1436079_NEGATIVE
378	158	113	177	117	NC_002950:PG0854|5end_hypothetical_protein_914870..915100_POSITIVE
377	60	14	225	169	NC_002950:PG0430|5end_ferrodoxin_oxidoreductase_beta_subunit_467986..468216_POSITIVE
375	159	114	91	36	NC_002950:PG2075|5end_hypothetical_protein_2176466..2176696_NEGATIVE
375	159	114	91	36	NC_002950:PG1266|5end_hypothetical_protein_1346987..1347217_NEGATIVE
374	86	43	229	185	NC_002950:PG1369|5end_glycerol-3-phosphate_dehydrogenase_(NAD(P)+)_1450407..1450637_NEGATIVE
372	57	11	73	12	NC_002950:PG1022|5end_hypothetical_protein_1083537..1083767_POSITIVE
372	158	115	219	175	NC_002950:PG0975|5end_PhoH_family_protein_1037284..1037514_POSITIVE
371	60	11	85	30	NC_002950:PG1812|5end_2-oxoglutarate_ferredoxin_oxidoreductase_1908107..1908337_NEGATIVE
370	80	35	160	120	NC_002950:PG1964|5end_bacterial_sugar_transferase_2052910..2053140_POSITIVE
368	77	38	47	4	NC_002950:PG1572|5end_hypothetical_protein_1651252..1651482_NEGATIVE
364	54	17	79	43	NC_002950:PG1040|5end_transcriptional_regulator,_putative_1107949..1108179_NEGATIVE
363	80	34	73	16	NC_002950:PG0746|5end_sensor_histidine_kinase_793903..794133_NEGATIVE
362	68	25	162	119	NC_002950:PG1163|5end_cobyrinic_acid_a,c-diamide_synthase_1243381..1243611_NEGATIVE
361	74	32	160	125	NC_002950:PG1715|5end_hypothetical_protein_1806056..1806286_NEGATIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
410	76	36	56	21	NC_002950:PG1459|3end_hypothetical_protein_1539632..1539782_NEGATIVE
408	156	113	143	100	NC_002950:PG0010|3end_ATP-dependent_Clp_protease,_ATP-binding_subunit_ClpC_11434..11584_POSITIVE
401	168	125	92	44	NC_002950:PG0332|3end_transcription_termination_factor_Rho_367675..367825_POSITIVE
386	89	43	147	99	NC_002950:PG1370|3end_lysyl-tRNA_synthetase_1450493..1450643_NEGATIVE
376	66	21	121	72	NC_002950:PG2037|3end_hypothetical_protein_2137591..2137741_NEGATIVE
364	54	17	58	22	NC_002950:PG1041|3end_K+-dependent_Na+/Ca+_exchanger_related-protein_1107970..1108120_NEGATIVE
363	80	34	76	19	NC_002950:PG0747|3end_sigma-54_dependent_DNA-binding_response_regulator_793900..794050_NEGATIVE
362	157	115	151	99	NC_002950:PG1687|3end_HIT_family_protein_1773812..1773962_NEGATIVE
359	150	102	89	45	NC_002950:PG0328|3end_imidazolonepropionase_362155..362305_NEGATIVE
358	74	34	54	19	NC_002950:PG1118|3end_clpB_protein_1192083..1192233_NEGATIVE
353	50	1	140	85	NC_002950:PG1956|3end_4-hydroxybutyrate_CoA-transferase_2046215..2046365_NEGATIVE
353	66	25	72	32	NC_002950:PG1613|3end_glyoxalase_family_protein_1693164..1693314_NEGATIVE
353	78	36	92	32	NC_002950:PG1104|3end_hypothetical_protein_1175782..1175932_POSITIVE
351	165	125	61	22	NC_002950:PG1007|3end_transcriptional_regulator,_GntR_family_1066518..1066668_NEGATIVE
351	169	126	99	44	NC_002950:PG0046|3end_phosphatidate_cytidylyltransferase_56346..56496_NEGATIVE
346	150	106	104	59	NC_002950:PG0669|3end_heme-binding_protein_FetB_720714..720864_POSITIVE
344	66	25	63	24	NC_002950:PG0524|3end_hypothetical_protein_568963..569113_POSITIVE
341	156	118	140	92	NC_002950:PG0555|3end_DNA-binding_protein,_histone-like_family_611716..611866_NEGATIVE
338	76	34	55	2	NC_002950:PG1876|3end_hypothetical_protein_1970633..1970783_NEGATIVE
337	66	21	45	6	NC_002950:PG1008|3end_hypothetical_protein_1066886..1067036_NEGATIVE