Origin IGS:
cccgacctgagcagcaaggaagaacgggaaagccaaaccgaaaaaagcagatatcgtaattgttgccggagatatgaatggcgacaaggcagccaagagataacaggacgtaatccccagattgataattaccgaaacagaatggagcaatgttccaattctgccccttgctttcttcttctttttttcactcatctcttgcagacgac
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
gtcgtctgcaagagatgagtgaaaaaaagaagaagaaagcaaggggcagaattggaacattgctccattctgtttcggtaattatcaatctggggattacgtcctgttatctcttggctgccttgtcgccattcatatctccggcaacaattacgatatctgcttttttcggtttggctttcccgttcttccttgctgctcaggtcggg

Mask Tandem Repeat Region ================================================
cccgacctgagcagcaaggaagaacgggaaagccaaaccgaaaaaagcagatatcgtaattgttgccggagatatgaatggcgacaaggcagccaagagataacaggacgtaatccccagattgataattaccgaaacagaatggagcaatgttccaattctgccccttgctttcttcttctttttttcactcatctcttgcagacgac

Find is-nt database================================================
Query_seq: PG1402:PG1403|PG1402:PG1403:AP endonuclease domain protein:rhomboid family protein:<-<-:1486054..1486262 209
cccgacctgagcagcaaggaagaacgggaaagccaaaccgaaaaaagcagatatcgtaattgttgccggagatatgaatggcgacaaggcagccaagagataacaggacgtaatccccagattgataattaccgaaacagaatggagcaatgttccaattctgccccttgctttcttcttctttttttcactcatctcttgcagacgac
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PG1402:PG1403|PG1402:PG1403:AP endonuclease domain protein:rhomboid family protein:<-<-:1486054..1486262 209
cccgacctgagcagcaaggaagaacgggaaagccaaaccgaaaaaagcagatatcgtaattgttgccggagatatgaatggcgacaaggcagccaagagataacaggacgtaatccccagattgataattaccgaaacagaatggagcaatgttccaattctgccccttgctttcttcttctttttttcactcatctcttgcagacgac
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PG1402:PG1403|PG1402:PG1403:AP endonuclease domain protein:rhomboid family protein:<-<-:1486054..1486262 209
cccgacctgagcagcaaggaagaacgggaaagccaaaccgaaaaaagcagatatcgtaattgttgccggagatatgaatggcgacaaggcagccaagagataacaggacgtaatccccagattgataattaccgaaacagaatggagcaatgttccaattctgccccttgctttcttcttctttttttcactcatctcttgcagacgac
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

cccgacctgagcagcaaggaagaacgggaaagccaaaccgaaaaaagcagatatcgtaattgttgccggagatatgaatggcgacaaggcagccaagagataacaggacgtaatccccagattgataattaccgaaacagaatggagcaatgttccaattctgccccttgctttcttcttctttttttcactcatctcttgcagacgac
Predict ORF larger than 30AA ================================================
Protein_Len: 60	Strand: +	Start: 7	End: 207
...... M  S  S  K  E  E  R  E  S  Q  T  E  K  S  R  Y  R  N  C  C  R  R  Y  E  W  R  Q  G  S  Q  E  I  T  G  R  N  P  Q  I  D  N  Y  R  N  R  M  E  Q  C  S  N  S  A  P  C  F  L  L  L  F ..
Protein_Len: 32	Strand: +	Start: 113	End: 208
................................................................................................................ M  P  R  L  I  I  T  E  T  E  W  S  N  V  P  I  L  P  L  A  F  F  F  F  F  S  L  I  S  C  R  R .
Protein_Len: 40	Strand: -	Start: 3	End: 122
.. S  R  L  L  L  S  S  R  S  L  W  V  S  F  L  L  Y  R  L  Q  Q  R  L  Y  S  H  R  C  P  L  W  S  I  V  P  R  L  G  W  M .......................................................................................
Protein_Len: 50	Strand: -	Start: 2	End: 151
. R  G  S  C  C  P  L  V  P  F  G  F  R  F  F  C  I  D  Y  N  N  G  S  I  H  I  A  V  L  C  G  L  S  L  L  V  Y  D  G  S  Q  Y  N  G  F  C  F  P  A  M ..........................................................
Protein_Len: 60	Strand: -	Start: 1	End: 204
 P  F  A  L  G  F  F  A  S  I  T  I  T  A  P  S  I  F  P  S  L  A  A  L  L  Y  C  S  T  I  G  L  N  I  I  V  S  V  S  H  L  L  T  G  I  R  G  R  A  K  K  K  K  K  E  S  M  E  Q  M .....

cccgacctgagcagcaaggaagaacgggaaagccaaaccgaaaaaagcagatatcgtaattgttgccggagatatgaatggcgacaaggcagccaagagataacaggacgtaatccccagattgataattaccgaaacagaatggagcaatgttccaattctgccccttgctttcttcttctttttttcactcatctcttgcagacgac
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

cccgacctgagcagcaaggaagaacgggaaagccaaaccgaaaaaagcagatatcgtaattgttgccggagatatgaatggcgacaaggcagccaagagataacaggacgtaatccccagattgataattaccgaaacagaatggagcaatgttccaattctgccccttgctttcttcttctttttttcactcatctcttgcagacgac
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: PG1402:PG1403|PG1402:PG1403:AP endonuclease domain protein:rhomboid family protein:<-<-:1486054..1486262 209
cccgacctgagcagcaaggaagaacgggaaagccaaaccgaaaaaagcagatatcgtaattgttgccggagatatgaatggcgacaaggcagccaagagataacaggacgtaatccccagattgataattaccgaaacagaatggagcaatgttccaattctgccccttgctttcttcttctttttttcactcatctcttgcagacgac
Intra-Species Hit: Count: 1	Min: 1	Max: 209	Len: 209
Subject: NC_002950_PG1402_PG1403|AP endonuclease domain protein:rhomboid family protein|NEGATIVE:NEGATIVE|[1486054,1486262]|209
HSP  1	e-value: 1.0E-102	bit: 373.0	Len: 209	Query Start:1	Query End:209	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 209
cccgacctgagcagcaaggaagaacgggaaagccaaaccgaaaaaagcagatatcgtaattgttgccggagatatgaatggcgacaaggcagccaagagataacaggacgtaatccccagattgataattaccgaaacagaatggagcaatgttccaattctgccccttgctttcttcttcnnnnnnncactcatctcttgcagacgac
cccgacctgagcagcaaggaagaacgggaaagccaaaccgaaaaaagcagatatcgtaattgttgccggagatatgaatggcgacaaggcagccaagagataacaggacgtaatccccagattgataattaccgaaacagaatggagcaatgttccaattctgccccttgctttcttcttctttttttcactcatctcttgcagacgac

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
CCCGACCUGAGCAGCAAGGAAGAACGGGAAAGCCAAACCGAAAAAAGCAGAUAUCGUAAUUGUUGCCGGAGAUAUGAAUGGCGACAAGGCAGCCAAGAGAUAACAGGACGUAAUCCCCAGAUUGAUAAUUACCGAAACAGAAUGGAGCAAUGUUCCAAUUCUGCCCCUUGCUUUCUUCUUCUUUUUUUCACUCAUCUCUUGCAGACGAC
...((..((((..(.(((((((((..(((((((..................((((....(((((((((..........)))))))))((...))....))))..(((...(((((....))))).............(((((((((((...))))).))))))..))).)))))))..))))))))).).))))..))........... (-48.50)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
GUCGUCUGCAAGAGAUGAGUGAAAAAAAGAAGAAGAAAGCAAGGGGCAGAAUUGGAACAUUGCUCCAUUCUGUUUCGGUAAUUAUCAAUCUGGGGAUUACGUCCUGUUAUCUCUUGGCUGCCUUGUCGCCAUUCAUAUCUCCGGCAACAAUUACGAUAUCUGCUUUUUUCGGUUUGGCUUUCCCGUUCUUCCUUGCUGCUCAGGUCGGG
.(((.(((((((.((.(((.((((..(((..((((((((((.(..(((((((.(((.......))))))))))..).((((((......((((((((.................((((.((...)).)))).....))))))))....))))))......))))))))))..)))...))))...))).)))))))......)).))). (-55.75)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
1019	50	1	141	92	NC_002950:PG1402|5end_AP_endonuclease_domain_protein_1485963..1486193_NEGATIVE
359	109	66	229	186	NC_002950:PG1947|5end_TPR_domain_protein_2032932..2033162_POSITIVE
343	110	61	181	136	NC_002950:PG1196|5end_hypothetical_protein_1275127..1275357_POSITIVE
342	99	64	164	118	NC_002950:PG0606|5end_hypothetical_protein_662558..662788_NEGATIVE
336	110	62	59	1	NC_002950:PG1966|5end_hypothetical_protein_2056924..2057154_NEGATIVE
334	110	64	67	20	NC_002950:PG2187|5end_1,4-dihydroxy-2-naphthoate_octaprenyltransferase_2294643..2294873_NEGATIVE
328	99	60	142	88	NC_002950:PG0518|5end_abortive_infection_protein_family_562939..563169_NEGATIVE
321	177	139	67	20	NC_002950:PG1913|5end_30S_ribosomal_protein_S11_2012926..2013156_NEGATIVE
321	90	47	226	178	NC_002950:PG0893|5end_hydroxylamine_reductase_955853..956083_NEGATIVE
317	48	2	219	178	NC_002950:PG1876|5end_hypothetical_protein_1971460..1971690_NEGATIVE
316	49	3	165	122	NC_002950:PG0677|5end_saccharopine_dehydrogenase_727653..727883_POSITIVE
313	35	7	90	52	NC_002950:PG0272|5end_CBS_domain_protein_304399..304629_POSITIVE
309	77	33	75	25	NC_002950:PG0754|5end_DNA_topoisomerase_I_800943..801173_POSITIVE
305	107	65	68	25	NC_002950:PG0115|5end_hexapeptide_transferase_family_protein_138038..138268_POSITIVE
304	186	141	148	102	NC_002950:PG2185|5end_transporter,_putative_2293249..2293479_NEGATIVE
304	110	66	165	118	NC_002950:PG1481|5end_conjugative_transposon_protein_TraG_1558447..1558677_NEGATIVE
303	107	62	47	7	NC_002950:PG1967|5end_TPR_domain_protein_2057168..2057398_POSITIVE
302	40	2	77	21	NC_002950:PG1855|5end_carboxyl-terminal_protease_1955476..1955706_NEGATIVE
297	110	61	139	78	NC_002950:PG1884|5end_alpha-L-fucosidase_precursor,_putative_1980992..1981222_NEGATIVE
297	48	1	72	18	NC_002950:PG0018|5end_hypothetical_protein_19648..19878_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
334	110	64	77	30	NC_002950:PG2188|3end_diaminopimelate_decarboxylase_2294633..2294783_NEGATIVE
321	177	139	55	8	NC_002950:PG1914|3end_30S_ribosomal_protein_S13_2012938..2013088_NEGATIVE
320	99	61	147	99	NC_002950:PG0308|3end_electron_transport_complex,_RnfABCDGE_type,_A_subunit_343827..343977_POSITIVE
307	179	133	77	24	NC_002950:PG0507|3end_hypothetical_protein_548190..548340_POSITIVE
305	89	48	130	80	NC_002950:PG0917|3end_GtrA_family_protein_977702..977852_NEGATIVE
304	186	141	113	67	NC_002950:PG2186|3end_transcriptional_regulator,_putative_2293284..2293434_NEGATIVE
302	40	2	69	13	NC_002950:PG1856|3end_cytidine/deoxycytidylate_deaminase_family_protein_1955484..1955634_NEGATIVE
302	50	1	49	8	NC_002950:PG0770|3end_hypothetical_protein_824159..824309_NEGATIVE
301	47	9	146	107	NC_002950:PG1359|3end_hypothetical_protein_1437644..1437794_NEGATIVE
300	177	131	59	14	NC_002950:PG1195|3end_8-amino-7-oxononanoate_synthase_1275207..1275357_POSITIVE
298	69	21	69	14	NC_002950:PG2105|3end_lipoprotein,_putative_2214579..2214729_POSITIVE
297	110	61	66	5	NC_002950:PG1885|3end_polyphosphate_kinase_1981065..1981215_NEGATIVE
297	48	1	68	14	NC_002950:PG0017|3end_sensor_histidine_kinase_19724..19874_POSITIVE
296	109	63	48	6	NC_002950:PG2210|3end_excinuclease_ABC,_A_subunit_2320952..2321102_NEGATIVE
296	97	56	151	111	NC_002950:PG1807|3end_v-type_ATPase,_subunit_K_1902625..1902775_POSITIVE
296	120	81	67	18	NC_002950:PG0954|3end_TPR_domain_protein_1015005..1015155_POSITIVE
294	180	131	51	5	NC_002950:PG2037|3end_hypothetical_protein_2137591..2137741_NEGATIVE
293	40	1	45	2	NC_002950:PG1978|3end_hypothetical_protein_2066723..2066873_NEGATIVE
293	49	1	100	48	NC_002950:PG0324|3end_histidine_ammonia-lyase_357589..357739_NEGATIVE
291	189	142	110	70	NC_002950:PG0400|3end_hypothetical_protein_436245..436395_NEGATIVE