Origin IGS:
gtatttcgatgctatcggttaggacggtacatggcaatcgaatctccataacttacaagggtgaaatccgtattacgaattatgaacggacgctctgttgcgatcggagccgatatggtggaatacacggcacaaccggagtctatgtaatccgtatcacaaaagattttttacagtctcagaagtttggtgtcaccgctattggatttttatgccgaaatatttggctatatgcaattttatggttactttgcgcagcaaaggaaagcaagtagagtgttttcctgaattttataaacaaaaaaaataaaagact
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
agtcttttattttttttgtttataaaattcaggaaaacactctacttgctttcctttgctgcgcaaagtaaccataaaattgcatatagccaaatatttcggcataaaaatccaatagcggtgacaccaaacttctgagactgtaaaaaatcttttgtgatacggattacatagactccggttgtgccgtgtattccaccatatcggctccgatcgcaacagagcgtccgttcataattcgtaatacggatttcacccttgtaagttatggagattcgattgccatgtaccgtcctaaccgatagcatcgaaatac

Mask Tandem Repeat Region ================================================
gtatttcgatgctatcggttaggacggtacatggcaatcgaatctccataacttacaagggtgaaatccgtattacgaattatgaacggacgctctgttgcgatcggagccgatatggtggaatacacggcacaaccggagtctatgtaatccgtatcacaaaagattttttacagtctcagaagtttggtgtcaccgctattggatttttatgccgaaatatttggctatatgcaattttatggttactttgcgcagcaaaggaaagcaagtagagtgttttcctgaattttataaacaaaaaaaataaaagact

Find is-nt database================================================
Query_seq: PG1490:PG1491|PG1490:PG1491:TraG family protein:hypothetical protein:->->:1565565..1565880 316
gtatttcgatgctatcggttaggacggtacatggcaatcgaatctccataacttacaagggtgaaatccgtattacgaattatgaacggacgctctgttgcgatcggagccgatatggtggaatacacggcacaaccggagtctatgtaatccgtatcacaaaagattttttacagtctcagaagtttggtgtcaccgctattggatttttatgccgaaatatttggctatatgcaattttatggttactttgcgcagcaaaggaaagcaagtagagtgttttcctgaattttataaacaaaaaaaataaaagact
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PG1490:PG1491|PG1490:PG1491:TraG family protein:hypothetical protein:->->:1565565..1565880 316
gtatttcgatgctatcggttaggacggtacatggcaatcgaatctccataacttacaagggtgaaatccgtattacgaattatgaacggacgctctgttgcgatcggagccgatatggtggaatacacggcacaaccggagtctatgtaatccgtatcacaaaagattttttacagtctcagaagtttggtgtcaccgctattggatttttatgccgaaatatttggctatatgcaattttatggttactttgcgcagcaaaggaaagcaagtagagtgttttcctgaattttataaacaaaaaaaataaaagact
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PG1490:PG1491|PG1490:PG1491:TraG family protein:hypothetical protein:->->:1565565..1565880 316
gtatttcgatgctatcggttaggacggtacatggcaatcgaatctccataacttacaagggtgaaatccgtattacgaattatgaacggacgctctgttgcgatcggagccgatatggtggaatacacggcacaaccggagtctatgtaatccgtatcacaaaagattttttacagtctcagaagtttggtgtcaccgctattggatttttatgccgaaatatttggctatatgcaattttatggttactttgcgcagcaaaggaaagcaagtagagtgttttcctgaattttataaacaaaaaaaataaaagact
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

gtatttcgatgctatcggttaggacggtacatggcaatcgaatctccataacttacaagggtgaaatccgtattacgaattatgaacggacgctctgttgcgatcggagccgatatggtggaatacacggcacaaccggagtctatgtaatccgtatcacaaaagattttttacagtctcagaagtttggtgtcaccgctattggatttttatgccgaaatatttggctatatgcaattttatggttactttgcgcagcaaaggaaagcaagtagagtgttttcctgaattttataaacaaaaaaaataaaagact
Predict ORF larger than 30AA ================================================
Protein_Len: 60	Strand: +	Start: 3	End: 272
.. M  S  M  L  S  V  R  T  V  H  G  N  R  I  S  I  T  Y  K  G  E  I  R  I  T  N  Y  E  R  T  L  C  C  D  R  S  R  Y  G  G  I  H  G  T  T  G  V  Y  V  I  R  I  T  K  D  F  L  Q  S  Q ............................................
Protein_Len: 40	Strand: +	Start: 166	End: 285
..................................................................................................................................................................... M  F  Y  S  L  R  S  L  V  S  P  L  L  D  F  Y  A  E  I  F  G  Y  M  Q  F  Y  G  Y  F  A  Q  Q  R  K  A  S  R  V  F  S ...............................
Protein_Len: 60	Strand: +	Start: 95	End: 307
.............................................................................................. M  L  R  S  E  P  I  W  W  N  T  R  H  N  R  S  L  C  N  P  Y  H  K  R  F  F  T  V  S  E  V  W  C  H  R  Y  W  I  F  M  P  K  Y  L  A  I  C  N  F  M  V  T  L  R  S  K  G  K  Q  V .........
Protein_Len: 40	Strand: -	Start: 182	End: 301
..................................................................................................................................................................................... F  N  P  T  V  A  I  P  N  K  H  R  F  I  Q  S  Y  A  I  K  H  N  S  Q  A  A  F  S  L  L  Y  L  T  K  R  F  K  I  F  M ...............
Protein_Len: 51	Strand: -	Start: 15	End: 167
.............. R  N  P  R  Y  M  A  I  S  D  G  Y  S  V  L  T  F  D  T  N  R  I  I  F  P  R  E  T  A  I  P  A  S  I  T  S  Y  V  A  C  G  S  D  I  Y  D  T  D  C  F  M .....................................................................................................................................................

gtatttcgatgctatcggttaggacggtacatggcaatcgaatctccataacttacaagggtgaaatccgtattacgaattatgaacggacgctctgttgcgatcggagccgatatggtggaatacacggcacaaccggagtctatgtaatccgtatcacaaaagattttttacagtctcagaagtttggtgtcaccgctattggatttttatgccgaaatatttggctatatgcaattttatggttactttgcgcagcaaaggaaagcaagtagagtgttttcctgaattttataaacaaaaaaaataaaagact
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================
PromScan Matrix: RpoD-17	Strand: -	Score: 84	Start: 9	End: 38
........ATTGCCATGTACCGTCCTAACCGATAGCAT......................................................................................................................................................................................................................................................................................

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

gtatttcgatgctatcggttaggacggtacatggcaatcgaatctccataacttacaagggtgaaatccgtattacgaattatgaacggacgctctgttgcgatcggagccgatatggtggaatacacggcacaaccggagtctatgtaatccgtatcacaaaagattttttacagtctcagaagtttggtgtcaccgctattggatttttatgccgaaatatttggctatatgcaattttatggttactttgcgcagcaaaggaaagcaagtagagtgttttcctgaattttataaacaaaaaaaataaaagact
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 46	HP_score: -4.2	Tail_Score: -2.80077	Start: 263	End: 285	Full_Region: ACTTTGCGCAGCAAA GGAAAGCA AGTAGAG TGTTTTCC TGAATTTTATAAACA
......................................................................................................................................................................................................................................................................GGAAAGCAAGTAGAGTGTTTTCC...............................

Find igs database================================================
Query_seq: PG1490:PG1491|PG1490:PG1491:TraG family protein:hypothetical protein:->->:1565565..1565880 316
gtatttcgatgctatcggttaggacggtacatggcaatcgaatctccataacttacaagggtgaaatccgtattacgaattatgaacggacgctctgttgcgatcggagccgatatggtggaatacacggcacaaccggagtctatgtaatccgtatcacaaaagattttttacagtctcagaagtttggtgtcaccgctattggatttttatgccgaaatatttggctatatgcaattttatggttactttgcgcagcaaaggaaagcaagtagagtgttttcctgaattttataaacaaaaaaaataaaagact
Intra-Species Hit: Count: 1	Min: 1	Max: 299	Len: 299
Subject: NC_002950_PG1490_PG1491|TraG family protein:hypothetical protein|POSITIVE:POSITIVE|[1565565,1565880]|316
HSP  1	e-value: 1.0E-168	bit: 593.0	Len: 299	Query Start:1	Query End:299	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 299
gtatttcgatgctatcggttaggacggtacatggcaatcgaatctccataacttacaagggtgaaatccgtattacgaattatgaacggacgctctgttgcgatcggagccgatatggtggaatacacggcacaaccggagtctatgtaatccgtatcacaaaagattttttacagtctcagaagtttggtgtcaccgctattggatttttatgccgaaatatttggctatatgcaattttatggttactttgcgcagcaaaggaaagcaagtagagtgttttcctgaattttataaac.................
gtatttcgatgctatcggttaggacggtacatggcaatcgaatctccataacttacaagggtgaaatccgtattacgaattatgaacggacgctctgttgcgatcggagccgatatggtggaatacacggcacaaccggagtctatgtaatccgtatcacaaaagattttttacagtctcagaagtttggtgtcaccgctattggatttttatgccgaaatatttggctatatgcaattttatggttactttgcgcagcaaaggaaagcaagtagagtgttttcctgaattttataaac.................

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
GUAUUUCGAUGCUAUCGGUUAGGACGGUACAUGGCAAUCGAAUCUCCAUAACUUACAAGGGUGAAAUCCGUAUUACGAAUUAUGAACGGACGCUCUGUUGCGAUCGGAGCCGAUAUGGUGGAAUACACGGCACAACCGGAGUCUAUGUAAUCCGUAUCACAAAAGAUUUUUUACAGUCUCAGAAGUUUGGUGUCACCGCUAUUGGAUUUUUAUGCCGAAAUAUUUGGCUAUAUGCAAUUUUAUGGUUACUUUGCGCAGCAAAGGAAAGCAAGUAGAGUGUUUUCCUGAAUUUUAUAAAC
....(((((((((((((.......))))....))).))))))...............((((((...(((((..............)))))))))))((((((...((((((((((((((.(((((..(((((......(((....(((((.....(((......)))...)))))..))).((((((..(((.......)))..))))))..)))))...))))).))))))).........))))).))...))))))..(((((((((.......)))))))))............. (-73.54)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
GUUUAUAAAAUUCAGGAAAACACUCUACUUGCUUUCCUUUGCUGCGCAAAGUAACCAUAAAAUUGCAUAUAGCCAAAUAUUUCGGCAUAAAAAUCCAAUAGCGGUGACACCAAACUUCUGAGACUGUAAAAAAUCUUUUGUGAUACGGAUUACAUAGACUCCGGUUGUGCCGUGUAUUCCACCAUAUCGGCUCCGAUCGCAACAGAGCGUCCGUUCAUAAUUCGUAAUACGGAUUUCACCCUUGUAAGUUAUGGAGAUUCGAUUGCCAUGUACCGUCCUAACCGAUAGCAUCGAAAUAC
.............((((((.((.......)).))))))(..((((.....((((........)))).....(((.........)))..............))))..)..((((((((..(((..((....((((((...(((.(((((((((.........((((((.((((.((((......))))))))..)))))).....((((....)))).))))))))).)))))))))))..)))..))))).)))...((((((.((..(((.(.((....)).)))))))))))).... (-59.80)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
443	138	92	229	175	NC_002950:PG1913|5end_30S_ribosomal_protein_S11_2012926..2013156_NEGATIVE
416	140	91	70	28	NC_002950:PG1486|5end_conjugative_transposon_protein_TraA_1561166..1561396_NEGATIVE
380	139	91	221	160	NC_002950:PG1927|5end_50S_ribosomal_protein_L24_2019557..2019787_NEGATIVE
366	135	92	175	136	NC_002950:PG1300|5end_hypothetical_protein_1379069..1379299_NEGATIVE
360	110	67	209	147	NC_002950:PG2082|5end_POT_family_protein_2183384..2183614_NEGATIVE
356	128	81	225	170	NC_002950:PG1594|5end_ComEC/Rec2-related_protein_1673587..1673817_NEGATIVE
354	129	88	73	20	NC_002950:PG1706|5end_hypothetical_protein_1794211..1794441_NEGATIVE
352	49	5	166	122	NC_002950:PG0002|5end_hexapeptide_transferase_family_protein_1295..1525_POSITIVE
349	118	91	39	11	NC_002950:PG1690|5end_Sua5/YciO/YrdC/YwlC_family_protein_1775773..1776003_NEGATIVE
348	129	87	217	168	NC_002950:PG2072|5end_UvrD/REP_helicase_domain_protein_2167369..2167599_POSITIVE
347	143	102	47	7	NC_002950:PG2150|5end_LysM_domain_protein_2259172..2259402_NEGATIVE
347	139	92	180	123	NC_002950:PG1250|5end_hypothetical_protein_1327846..1328076_NEGATIVE
346	130	81	226	174	NC_002950:PG2112|5end_hypothetical_protein_2221471..2221701_POSITIVE
341	140	98	178	142	NC_002950:PG1465|5end_hypothetical_protein_1541982..1542212_POSITIVE
340	131	91	168	120	NC_002950:PG1692|5end_ABC_transporter,_ATP-binding_protein_1777173..1777403_NEGATIVE
338	110	69	178	141	NC_002950:PG1729|5end_thiol_peroxidase_1818881..1819111_NEGATIVE
336	121	81	68	17	NC_002950:PG1305|5end_glycine_dehydrogenase_1386538..1386768_NEGATIVE
335	130	87	229	173	NC_002950:PG2223|5end_glycosyl_transferase,_group_2_family_protein_2337713..2337943_POSITIVE
335	57	15	152	99	NC_002950:PG1271|5end_acetylornithine_aminotransferase,_putative_1351443..1351673_NEGATIVE
334	120	71	228	169	NC_002950:PG1374|5end_immunoreactive_47_kDa_antigen_PG97_1456540..1456770_NEGATIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
366	135	92	138	99	NC_002950:PG1301|3end_hypothetical_protein_1379106..1379256_NEGATIVE
355	130	83	127	73	NC_002950:PG1758|3end_ribosomal_protein_S15_1845534..1845684_POSITIVE
351	130	87	60	9	NC_002950:PG1943|3end_hypothetical_protein_2028974..2029124_NEGATIVE
349	118	91	32	4	NC_002950:PG1691|3end_hypothetical_protein_1775780..1775930_NEGATIVE
344	46	1	92	49	NC_002950:PG1145|3end_long-chain-fatty-acid--CoA_ligase,_putative_1228482..1228632_NEGATIVE
340	131	92	59	6	NC_002950:PG1707|3end_hypothetical_protein_1794232..1794382_NEGATIVE
339	112	74	151	103	NC_002950:PG1977|3end_hypothetical_protein_2064687..2064837_NEGATIVE
338	110	69	132	95	NC_002950:PG1730|3end_O-methyltransferase_family_protein_1818927..1819077_NEGATIVE
336	121	81	63	12	NC_002950:PG1306|3end_metallo-beta-lactamase_family_protein_1386543..1386693_NEGATIVE
332	129	92	146	116	NC_002950:PG1484|3end_hypothetical_protein_1559275..1559425_NEGATIVE
328	130	87	89	42	NC_002950:PG1975|3end_hemagglutinin_protein_HagC_2064350..2064500_POSITIVE
328	123	81	78	28	NC_002950:PG1459|3end_hypothetical_protein_1539632..1539782_NEGATIVE
328	129	81	103	40	NC_002950:PG0534|3end_hypothetical_protein_585805..585955_POSITIVE
326	135	92	48	1	NC_002950:PG0413|3end_hypothetical_protein_451437..451587_NEGATIVE
325	130	82	76	30	NC_002950:PG1885|3end_polyphosphate_kinase_1981065..1981215_NEGATIVE
324	129	87	76	22	NC_002950:PG0246|3end_hypothetical_protein_281050..281200_NEGATIVE
323	139	92	77	11	NC_002950:PG1371|3end_phosphorylase_family_protein_1452352..1452502_NEGATIVE
323	109	76	74	37	NC_002950:PG0733|3end_riboflavin_synthase_subunit_alpha_783856..784006_POSITIVE
322	47	5	151	109	NC_002950:PG0001|3end_chromosomal_replication_initiation_protein_1362..1512_POSITIVE
321	138	96	60	21	NC_002950:PG2123|3end_hypothetical_protein_2230243..2230393_POSITIVE