Origin IGS:
actcaaaagaatatccccgaaaaggggtataatacatttatattccttatatttgccactgataaggtatataatgactttctcggagtgagccgtgcatagtgatatgccttgaatatgtacccaaaagagacaaaatgggtacatatccttgggacgtgtacccgaaaacggcatttggggtacatattcggaatatggaacttcaagcaatcgatgtaag
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
cttacatcgattgcttgaagttccatattccgaatatgtaccccaaatgccgttttcgggtacacgtcccaaggatatgtacccattttgtctcttttgggtacatattcaaggcatatcactatgcacggctcactccgagaaagtcattatataccttatcagtggcaaatataaggaatataaatgtattataccccttttcggggatattcttttgagt

Mask Tandem Repeat Region ================================================
actcaaaagaatatccccgaaaaggggtataatacatttatattccttatatttgccactgataaggtatataatgactttctcggagtgagccgtgcatagtgatatgccttgaatatgtacccaaaagagacaaaatgggtacatatccttgggacgtgtacccgaaaacggcatttggggtacatattcggaatatggaacttcaagcaatcgatgtaag

Find is-nt database================================================
Query_seq: PG0856:PG0857|PG0856:PG0857:hypothetical protein:transcriptional regulator, putative:->->:917236..917458 223
actcaaaagaatatccccgaaaaggggtataatacatttatattccttatatttgccactgataaggtatataatgactttctcggagtgagccgtgcatagtgatatgccttgaatatgtacccaaaagagacaaaatgggtacatatccttgggacgtgtacccgaaaacggcatttggggtacatattcggaatatggaacttcaagcaatcgatgtaag
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PG0856:PG0857|PG0856:PG0857:hypothetical protein:transcriptional regulator, putative:->->:917236..917458 223
actcaaaagaatatccccgaaaaggggtataatacatttatattccttatatttgccactgataaggtatataatgactttctcggagtgagccgtgcatagtgatatgccttgaatatgtacccaaaagagacaaaatgggtacatatccttgggacgtgtacccgaaaacggcatttggggtacatattcggaatatggaacttcaagcaatcgatgtaag
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PG0856:PG0857|PG0856:PG0857:hypothetical protein:transcriptional regulator, putative:->->:917236..917458 223
actcaaaagaatatccccgaaaaggggtataatacatttatattccttatatttgccactgataaggtatataatgactttctcggagtgagccgtgcatagtgatatgccttgaatatgtacccaaaagagacaaaatgggtacatatccttgggacgtgtacccgaaaacggcatttggggtacatattcggaatatggaacttcaagcaatcgatgtaag
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

actcaaaagaatatccccgaaaaggggtataatacatttatattccttatatttgccactgataaggtatataatgactttctcggagtgagccgtgcatagtgatatgccttgaatatgtacccaaaagagacaaaatgggtacatatccttgggacgtgtacccgaaaacggcatttggggtacatattcggaatatggaacttcaagcaatcgatgtaag
Predict ORF larger than 30AA ================================================
Protein_Len: 41	Strand: +	Start: 99	End: 221
.................................................................................................. M  V  I  C  L  E  Y  V  P  K  R  D  K  M  G  T  Y  P  W  D  V  Y  P  K  T  A  F  G  V  H  I  R  N  M  E  L  Q  A  I  D  V ..
Protein_Len: 37	Strand: +	Start: 112	End: 219
............................................................................................................... M  N  M  Y  P  K  E  T  K  W  V  H  I  L  G  T  C  T  R  K  R  H  L  G  Y  I  F  G  I  W  N  F  K  Q  S  M  * ....
Protein_Len: 36	Strand: +	Start: 116	End: 223
................................................................................................................... M  C  T  Q  K  R  Q  N  G  Y  I  S  L  G  R  V  P  E  N  G  I  W  G  T  Y  S  E  Y  G  T  S  S  N  R  C  K 
Protein_Len: 50	Strand: -	Start: 50	End: 199
................................................. I  Q  W  Q  Y  P  I  Y  H  S  E  R  L  S  G  H  M  T  I  H  R  S  Y  T  G  L  L  S  L  I  P  V  Y  G  Q  S  T  Y  G  F  V  A  N  P  T  C  I  R  F  M ........................
Protein_Len: 60	Strand: -	Start: 6	End: 218
..... I  N  R  I  N  A  V  S  L  T  Y  L  S  K  R  P  T  L  R  A  Y  H  Y  A  K  F  I  Y  G  F  S  V  F  H  T  C  I  R  P  V  H  V  R  F  R  C  K  P  Y  M  N  P  I  H  F  K  L  C  D  M .....
Protein_Len: 60	Strand: -	Start: 1	End: 213
 C  K  Y  E  K  Y  K  G  S  I  L  Y  I  I  V  K  E  S  H  A  T  C  L  S  I  G  Q  I  H  V  W  F  L  C  F  P  Y  M  D  K  P  R  T  G  S  F  P  M  Q  P  V  Y  E  S  Y  P  V  E  L  M ..........

actcaaaagaatatccccgaaaaggggtataatacatttatattccttatatttgccactgataaggtatataatgactttctcggagtgagccgtgcatagtgatatgccttgaatatgtacccaaaagagacaaaatgggtacatatccttgggacgtgtacccgaaaacggcatttggggtacatattcggaatatggaacttcaagcaatcgatgtaag
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

actcaaaagaatatccccgaaaaggggtataatacatttatattccttatatttgccactgataaggtatataatgactttctcggagtgagccgtgcatagtgatatgccttgaatatgtacccaaaagagacaaaatgggtacatatccttgggacgtgtacccgaaaacggcatttggggtacatattcggaatatggaacttcaagcaatcgatgtaag
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 47	HP_score: -4.6	Tail_Score: -2.72049	Start: 117	End: 148	Full_Region: GTGATATGCCTTGAA TATGTACCCA AAAGAGACAAAA TGGGTACATA TCCTTGGGACGTGTA
....................................................................................................................TATGTACCCAAAAGAGACAAAATGGGTACATA...........................................................................
TransTerm Strand: +	Conf: 43	HP_score: -2.8	Tail_Score: -2.90392	Start: 119	End: 146	Full_Region: GATATGCCTTGAATA TGTACCCA AAAGAGACAAAA TGGGTACA TATCCTTGGGACGTG
......................................................................................................................TGTACCCAAAAGAGACAAAATGGGTACA.............................................................................
TransTerm Strand: -	Conf: 43	HP_score: -2.8	Tail_Score: -3.02829	Start: 119	End: 146	Full_Region: cacgtcccaaggata tgtaccca ttttgtctcttt tgggtaca tattcaaggcatatc
......................................................................................................................tgtacccattttgtctcttttgggtaca.............................................................................
TransTerm Strand: -	Conf: 87	HP_score: -8.1	Tail_Score: -4.78933	Start: 139	End: 167	Full_Region: cccaaatgccgtttt cgggtacacgtcc caa ggatatgtaccca ttttgtctcttttgg
..........................................................................................................................................cgggtacacgtcccaaggatatgtaccca........................................................
TransTerm Strand: -	Conf: 85	HP_score: -11.6	Tail_Score: -3.45733	Start: 140	End: 166	Full_Region: ccaaatgccgttttc gggtacacgtcc caa ggatatgtaccc attttgtctcttttg
...........................................................................................................................................gggtacacgtcccaaggatatgtaccc.........................................................
TransTerm Strand: +	Conf: 61	HP_score: -7.1	Tail_Score: -3.05343	Start: 160	End: 187	Full_Region: CATATCCTTGGGACG TGTACCCGAAA ACGGCA TTTGGGGTACA TATTCGGAATATGGA
...............................................................................................................................................................TGTACCCGAAAACGGCATTTGGGGTACA....................................

Find igs database================================================
Query_seq: PG0856:PG0857|PG0856:PG0857:hypothetical protein:transcriptional regulator, putative:->->:917236..917458 223
actcaaaagaatatccccgaaaaggggtataatacatttatattccttatatttgccactgataaggtatataatgactttctcggagtgagccgtgcatagtgatatgccttgaatatgtacccaaaagagacaaaatgggtacatatccttgggacgtgtacccgaaaacggcatttggggtacatattcggaatatggaacttcaagcaatcgatgtaag
Intra-Species Hit: Count: 1	Min: 1	Max: 223	Len: 223
Subject: NC_002950_PG0856_PG0857|hypothetical protein:transcriptional regulator, putative|POSITIVE:POSITIVE|[917236,917458]|223
HSP  1	e-value: 1.0E-123	bit: 442.0	Len: 223	Query Start:1	Query End:223	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 223
actcaaaagaatatccccgaaaaggggtataatacatttatattccttatatttgccactgataaggtatataatgactttctcggagtgagccgtgcatagtgatatgccttgaatatgtacccaaaagagacaaaatgggtacatatccttgggacgtgtacccgaaaacggcatttggggtacatattcggaatatggaacttcaagcaatcgatgtaag
actcaaaagaatatccccgaaaaggggtataatacatttatattccttatatttgccactgataaggtatataatgactttctcggagtgagccgtgcatagtgatatgccttgaatatgtacccaaaagagacaaaatgggtacatatccttgggacgtgtacccgaaaacggcatttggggtacatattcggaatatggaacttcaagcaatcgatgtaag


Inter-species Hit: Count: 1	Min: 10	Max: 210	Len: 201
Subject: tfor_TF1543_TF1544|conserved hypothetical protein:possible transcriptional regulator|POSITIVE:POSITIVE|[1650835,1651049]|215
HSP  1	e-value: 3.0E-79	bit: 295.0	Len: 201	Query Start:10	Query End:210	Subject Strand: POSITIVE	Subject Start: 3	Subject End: 203
.........aatatccccgaaaaggggtataatacatttatattccttatatttgccactgataaggtatataatgactttctcggagtgagccgtgcatagtgatatgccttgaatatgtacccaaaagagacaaaatgggtacatatccttgggacgtgtacccgaaaacggcatttggggtacatattcggaatatggaacttcaag.............
.........aatacccccgaaaaggggtataattgattcctattccttatatttgccactgataaggtatataatgactttggcggagtgagtcgtgcatagtgatataccttgaatatgtacccaaaagagacaaaatgggtacatatccttgagacgtgtacccgaaaacggcattttgggtacatattcggaatgtggtacttcaag.............


Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AAUAUCCCCGAAAAGGGGUAUAAUACAUUUAUAUUCCUUAUAUUUGCCACUGAUAAGGUAUAUAAUGACUUUCUCGGAGUGAGCCGUGCAUAGUGAUAUGCCUUGAAUAUGUACCCAAAAGAGACAAAAUGGGUACAUAUCCUUGGGACGUGUACCCGAAAACGGCAUUUGGGGUACAUAUUCGGAAUAUGGAACUUCAAG
..(((((((.....)))).)))...((((.((((.((((((...........)))))).))))))))........(((((...(((((((((....))))).((((((((((((((.(((.........((((((((..(((...)))..)))))))).........))).))))))))))))))...)))).)))))... (-67.57)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
CUUGAAGUUCCAUAUUCCGAAUAUGUACCCCAAAUGCCGUUUUCGGGUACACGUCCCAAGGAUAUGUACCCAUUUUGUCUCUUUUGGGUACAUAUUCAAGGCAUAUCACUAUGCACGGCUCACUCCGAGAAAGUCAUUAUAUACCUUAUCAGUGGCAAAUAUAAGGAAUAUAAAUGUAUUAUACCCCUUUUCGGGGAUAUU
((((.(((.((.......((((((((((((.(((..........(((((((..(((...)))..)))))))..........))).))))))))))))...(((((....)))))..))...))).)))).......((((((.((((((...........)))))).))))))..........((((.....))))..... (-59.55)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
522	78	32	210	163	NC_002950:PG0855|5end_hypothetical_protein_916055..916285_NEGATIVE
338	186	141	186	122	NC_002950:PG1102|5end_hypothetical_protein_1173637..1173867_NEGATIVE
324	184	141	227	187	NC_002950:PG0259|5end_hypothetical_protein_292278..292508_POSITIVE
315	175	131	213	168	NC_002950:PG1812|5end_2-oxoglutarate_ferredoxin_oxidoreductase_1908107..1908337_NEGATIVE
314	177	135	60	10	NC_002950:PG1715|5end_hypothetical_protein_1806056..1806286_NEGATIVE
311	115	74	143	112	NC_002950:PG1354|5end_hydrolase,_carbon-nitrogen_family_1434765..1434995_NEGATIVE
310	177	131	143	86	NC_002950:PG0614|5end_hypothetical_protein_665847..666077_POSITIVE
309	117	73	96	54	NC_002950:PG1566|5end_glutamyl-tRNA_synthetase_1647401..1647631_NEGATIVE
307	173	131	80	31	NC_002950:PG1594|5end_ComEC/Rec2-related_protein_1673587..1673817_NEGATIVE
300	173	140	188	152	NC_002950:PG1719|5end_ABC_transporter,_ATP-binding_protein,_MsbA_family_1806749..1806979_POSITIVE
300	186	143	223	172	NC_002950:PG1645|5end_ISPg5,_transposase_Orf1_1726062..1726292_NEGATIVE
300	90	45	174	135	NC_002950:PG1171|5end_oxidoreductase,_putative_1250355..1250585_POSITIVE
298	172	131	174	119	NC_002950:PG0145|5end_hypothetical_protein_167831..168061_POSITIVE
297	96	67	215	182	NC_002950:PG1101|5end_sodium:solute_symporter_family_protein_1170469..1170699_NEGATIVE
297	89	48	200	151	NC_002950:PG0492|5end_hypothetical_protein_534668..534898_NEGATIVE
297	90	42	187	146	NC_002950:PG0171|5end_5'-nucleotidase_family_protein_191724..191954_POSITIVE
296	115	74	62	21	NC_002950:PG2026|5end_phosphoglycerate_mutase_family_protein_2124932..2125162_POSITIVE
294	118	72	61	10	NC_002950:PG1863|5end_hypothetical_protein_1960516..1960746_NEGATIVE
294	118	72	214	163	NC_002950:PG1862|5end_hypothetical_protein_1960363..1960593_NEGATIVE
294	185	141	220	175	NC_002950:PG1600|5end_hypothetical_protein_1680984..1681214_NEGATIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
321	89	45	126	74	NC_002950:PG1426|3end_hypothetical_protein_1511152..1511302_NEGATIVE
312	94	62	132	98	NC_002950:PG0265|3end_hypothetical_protein_298393..298543_NEGATIVE
311	115	74	146	115	NC_002950:PG1355|3end_acyltransferase,_putative_1434762..1434912_NEGATIVE
307	173	131	73	24	NC_002950:PG1595|3end_ribulose-phosphate_3-epimerase_1673594..1673744_NEGATIVE
297	89	48	126	77	NC_002950:PG0493|3end_hypothetical_protein_534742..534892_NEGATIVE
295	186	142	61	18	NC_002950:PG1966|3end_hypothetical_protein_2056118..2056268_NEGATIVE
295	183	142	51	5	NC_002950:PG0858|3end_hypothetical_protein_917955..918105_POSITIVE
294	118	72	68	17	NC_002950:PG1864|3end_leucine-rich_protein_1960509..1960659_NEGATIVE
293	114	71	151	107	NC_002950:PG2102|3end_immunoreactive_61_kDa_antigen_PG91_2211424..2211574_NEGATIVE
293	90	44	106	61	NC_002950:PG0738|3end_cytidine/deoxycytidylate_deaminase_family_protein_786995..787145_POSITIVE
292	159	117	117	78	NC_002950:PG2091|3end_dihydroneopterin_aldolase_2191610..2191760_POSITIVE
291	175	131	62	15	NC_002950:PG0703|3end_cobalamin_(5'-phosphate)_synthase,_putative_759006..759156_POSITIVE
291	199	151	76	15	NC_002950:PG0664|3end_oxidoreductase,_Gfo/Idh/MocA_family_711860..712010_POSITIVE
290	188	141	122	82	NC_002950:PG1523|3end_naphthoate_synthase_1600170..1600320_NEGATIVE
289	105	67	72	29	NC_002950:PG0627|3end_RNA-binding_protein_681142..681292_NEGATIVE
289	160	114	142	101	NC_002950:PG0431|3end_hypothetical_protein_469174..469324_POSITIVE
288	167	126	60	25	NC_002950:PG0508|3end_HAD-superfamily_subfamily_IB_hydrolase,_TIGR01490_548136..548286_NEGATIVE
284	182	141	54	17	NC_002950:PG0343|3end_methionine_gamma-lyase_377181..377331_NEGATIVE
282	87	43	144	90	NC_002950:PG1044|3end_iron_dependent_repressor,_putative_1112886..1113036_NEGATIVE
277	187	141	142	101	NC_002950:PG0722|3end_hypothetical_protein_774739..774889_NEGATIVE