Origin IGS:
aaaaacaggacaacgaactgtgaaagccgatcggggcgttcggcttgtcctcactttgctctgattccttagtgagcagacaaagaatatggacaaagccgatgcatccgcaacgaccgactctgtttcagggttgctatttcagaatacaagaccgaaattattactttttataactaaaaaccaaa
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
tttggtttttagttataaaaagtaataatttcggtcttgtattctgaaatagcaaccctgaaacagagtcggtcgttgcggatgcatcggctttgtccatattctttgtctgctcactaaggaatcagagcaaagtgaggacaagccgaacgccccgatcggctttcacagttcgttgtcctgttttt

Mask Tandem Repeat Region ================================================
aaaaacaggacaacgaactgtgaaagccgatcggggcgttcggcttgtcctcactttgctctgattccttagtgagcagacaaagaatatggacaaagccgatgcatccgcaacgaccgactctgtttcagggttgctatttcagaatacaagaccgaaattattactttttataactaaaaaccaaa

Find is-nt database================================================
Query_seq: PG0547:PG0548|PG0547:PG0548:hypothetical protein:pyruvate ferredoxin/flavodoxin oxidoreductase family protein:->->:602050..602237 188
aaaaacaggacaacgaactgtgaaagccgatcggggcgttcggcttgtcctcactttgctctgattccttagtgagcagacaaagaatatggacaaagccgatgcatccgcaacgaccgactctgtttcagggttgctatttcagaatacaagaccgaaattattactttttataactaaaaaccaaa
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PG0547:PG0548|PG0547:PG0548:hypothetical protein:pyruvate ferredoxin/flavodoxin oxidoreductase family protein:->->:602050..602237 188
aaaaacaggacaacgaactgtgaaagccgatcggggcgttcggcttgtcctcactttgctctgattccttagtgagcagacaaagaatatggacaaagccgatgcatccgcaacgaccgactctgtttcagggttgctatttcagaatacaagaccgaaattattactttttataactaaaaaccaaa
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PG0547:PG0548|PG0547:PG0548:hypothetical protein:pyruvate ferredoxin/flavodoxin oxidoreductase family protein:->->:602050..602237 188
aaaaacaggacaacgaactgtgaaagccgatcggggcgttcggcttgtcctcactttgctctgattccttagtgagcagacaaagaatatggacaaagccgatgcatccgcaacgaccgactctgtttcagggttgctatttcagaatacaagaccgaaattattactttttataactaaaaaccaaa
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

aaaaacaggacaacgaactgtgaaagccgatcggggcgttcggcttgtcctcactttgctctgattccttagtgagcagacaaagaatatggacaaagccgatgcatccgcaacgaccgactctgtttcagggttgctatttcagaatacaagaccgaaattattactttttataactaaaaaccaaa
Predict ORF larger than 30AA ================================================
Protein_Len: 48	Strand: +	Start: 30	End: 173
............................. M  G  A  F  G  L  S  S  L  C  S  D  S  L  V  S  R  Q  R  I  W  T  K  P  M  H  P  Q  R  P  T  L  F  Q  G  C  Y  F  R  I  Q  D  R  N  Y  Y  F  L ...............
Protein_Len: 33	Strand: +	Start: 89	End: 187
........................................................................................ M  D  K  A  D  A  S  A  T  T  D  S  V  S  G  L  L  F  Q  N  T  R  P  K  L  L  L  F  I  T  K  N  Q .
Protein_Len: 31	Strand: -	Start: 72	End: 164
....................................................................... H  A  S  L  S  Y  P  C  L  R  H  M  R  L  S  R  S  Q  K  L  T  A  I  E  S  Y  L  V  S  I  M ........................
Protein_Len: 34	Strand: -	Start: 2	End: 103
. F  C  S  L  S  S  H  F  G  I  P  A  N  P  K  D  E  S  Q  E  S  E  K  T  L  L  C  L  I  H  V  F  G  M .....................................................................................
Protein_Len: 32	Strand: -	Start: 1	End: 96
 F  V  P  C  R  V  T  F  A  S  R  P  T  R  S  T  R  V  K  S  Q  N  R  L  S  C  V  F  F  I  S  M ............................................................................................

aaaaacaggacaacgaactgtgaaagccgatcggggcgttcggcttgtcctcactttgctctgattccttagtgagcagacaaagaatatggacaaagccgatgcatccgcaacgaccgactctgtttcagggttgctatttcagaatacaagaccgaaattattactttttataactaaaaaccaaa
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

aaaaacaggacaacgaactgtgaaagccgatcggggcgttcggcttgtcctcactttgctctgattccttagtgagcagacaaagaatatggacaaagccgatgcatccgcaacgaccgactctgtttcagggttgctatttcagaatacaagaccgaaattattactttttataactaaaaaccaaa
Predict TransTerm conf > 70================================================
TransTerm Strand: -	Conf: 79	HP_score: -10.2	Tail_Score: -3.62478	Start: 26	End: 44	Full_Region: gcaaagtgaggacaa gccgaacg ccc cgatcggc tttcacagttcgttg
.........................gccgaacgccccgatcggc................................................................................................................................................

Find igs database================================================
Query_seq: PG0547:PG0548|PG0547:PG0548:hypothetical protein:pyruvate ferredoxin/flavodoxin oxidoreductase family protein:->->:602050..602237 188
aaaaacaggacaacgaactgtgaaagccgatcggggcgttcggcttgtcctcactttgctctgattccttagtgagcagacaaagaatatggacaaagccgatgcatccgcaacgaccgactctgtttcagggttgctatttcagaatacaagaccgaaattattactttttataactaaaaaccaaa
Intra-Species Hit: Count: 1	Min: 1	Max: 188	Len: 188
Subject: NC_002950_PG0547_PG0548|hypothetical protein:pyruvate ferredoxin/flavodoxin oxidoreductase family protein|POSITIVE:POSITIVE|[602050,602237]|188
HSP  1	e-value: 1.0E-102	bit: 373.0	Len: 188	Query Start:1	Query End:188	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 188
aaaaacaggacaacgaactgtgaaagccgatcggggcgttcggcttgtcctcactttgctctgattccttagtgagcagacaaagaatatggacaaagccgatgcatccgcaacgaccgactctgtttcagggttgctatttcagaatacaagaccgaaattattactttttataactaaaaaccaaa
aaaaacaggacaacgaactgtgaaagccgatcggggcgttcggcttgtcctcactttgctctgattccttagtgagcagacaaagaatatggacaaagccgatgcatccgcaacgaccgactctgtttcagggttgctatttcagaatacaagaccgaaattattactttttataactaaaaaccaaa

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AAAAACAGGACAACGAACUGUGAAAGCCGAUCGGGGCGUUCGGCUUGUCCUCACUUUGCUCUGAUUCCUUAGUGAGCAGACAAAGAAUAUGGACAAAGCCGAUGCAUCCGCAACGACCGACUCUGUUUCAGGGUUGCUAUUUCAGAAUACAAGACCGAAAUUAUUACUUUUUAUAACUAAAAACCAAA
.......((.........(.(((((..((..((((((((.((((((((((...(((((.((((.(((......)))))))))))).....)))).)))))))))).))))...))..((((((((...))))))))...))))).)..........((((........))))...........))... (-47.70)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UUUGGUUUUUAGUUAUAAAAAGUAAUAAUUUCGGUCUUGUAUUCUGAAAUAGCAACCCUGAAACAGAGUCGGUCGUUGCGGAUGCAUCGGCUUUGUCCAUAUUCUUUGUCUGCUCACUAAGGAAUCAGAGCAAAGUGAGGACAAGCCGAACGCCCCGAUCGGCUUUCACAGUUCGUUGUCCUGUUUUU
.(((.((((((....)))))).)))..(((((((.........))))))).(((((.(((....(((((((((((..(((......(((((((.((((.....(((((((((.((......))..)))).)))))...))))))))))).)))..)))))))))))..)))...)))))......... (-54.90)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
476	50	4	77	15	NC_002950:PG1966|5end_hypothetical_protein_2056924..2057154_NEGATIVE
431	78	31	66	19	NC_002950:PG1454|5end_integrase_1538106..1538336_NEGATIVE
431	78	31	66	19	NC_002950:PG0819|5end_integrase_877326..877556_POSITIVE
420	74	33	231	175	NC_002950:PG0961|5end_hypothetical_protein_1022272..1022502_NEGATIVE
412	70	26	190	129	NC_002950:PG1617|5end_hypothetical_protein_1697755..1697985_NEGATIVE
393	64	21	177	135	NC_002950:PG1269|5end_delta-1-pyrroline-5-carboxylate_dehydrogenase_1349201..1349431_NEGATIVE
393	65	27	191	149	NC_002950:PG0659|5end_hypothetical_protein_709148..709378_NEGATIVE
386	79	32	52	4	NC_002950:PG0851|5end_hypothetical_protein_912732..912962_NEGATIVE
374	50	5	216	165	NC_002950:PG1042|5end_glycogen_synthase,_putative_1110638..1110868_NEGATIVE
365	59	12	213	162	NC_002950:PG1847|5end_endoribonuclease_L-PSP,_putative_1946607..1946837_NEGATIVE
365	138	91	207	158	NC_002950:PG1499|5end_hypothetical_protein_1575524..1575754_POSITIVE
364	50	6	184	132	NC_002950:PG0829|5end_hypothetical_protein_886746..886976_NEGATIVE
360	63	26	168	135	NC_002950:PG0327|5end_hypothetical_protein_362061..362291_NEGATIVE
356	49	7	183	139	NC_002950:PG1242|5end_replicative_DNA_helicase_1317435..1317665_POSITIVE
355	61	26	192	150	NC_002950:PG1633|5end_galactokinase_1713385..1713615_POSITIVE
351	49	12	167	124	NC_002950:PG2031|5end_hypothetical_protein_2130339..2130569_POSITIVE
351	70	25	108	61	NC_002950:PG0844|5end_hypothetical_protein_905289..905519_POSITIVE
350	137	91	104	41	NC_002950:PG0326|5end_hypothetical_protein_360974..361204_NEGATIVE
349	80	31	51	2	NC_002950:PG0143|5end_hydrolase,_carbon-nitrogen_family_166625..166855_NEGATIVE
347	139	97	216	163	NC_002950:PG1134|5end_thioredoxin_reductase_1214350..1214580_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
408	137	97	49	15	NC_002950:PG0317|3end_peptidase,_M49_family_349771..349921_NEGATIVE
393	64	21	100	58	NC_002950:PG1270|3end_hypothetical_protein_1349278..1349428_NEGATIVE
387	67	25	135	86	NC_002950:PG1473|3end_conjugative_transposon_protein_TraQ_1549761..1549911_NEGATIVE
387	69	25	136	88	NC_002950:PG1218|3end_hypothetical_protein_1296475..1296625_POSITIVE
365	49	6	150	103	NC_002950:PG1402|3end_AP_endonuclease_domain_protein_1485031..1485181_NEGATIVE
360	63	26	74	41	NC_002950:PG0328|3end_imidazolonepropionase_362155..362305_NEGATIVE
356	49	7	148	104	NC_002950:PG1241|3end_GTP-binding_protein_LepA_1317480..1317630_POSITIVE
355	61	26	142	100	NC_002950:PG1632|3end_aldose_1-epimerase_1713415..1713565_POSITIVE
354	59	14	102	59	NC_002950:PG1104|3end_hypothetical_protein_1175782..1175932_POSITIVE
348	79	31	113	62	NC_002950:PG1942|3end_30S_ribosomal_protein_S12_2027946..2028096_NEGATIVE
343	51	18	41	4	NC_002950:PG1739|3end_hypothetical_protein_1825128..1825278_NEGATIVE
343	76	33	123	83	NC_002950:PG0843|3end_hypothetical_protein_904871..905021_NEGATIVE
343	80	43	102	59	NC_002950:PG0669|3end_heme-binding_protein_FetB_720714..720864_POSITIVE
341	69	25	122	61	NC_002950:PG0132|3end_hypothetical_protein_153054..153204_POSITIVE
339	60	13	70	16	NC_002950:PG0555|3end_DNA-binding_protein,_histone-like_family_611716..611866_NEGATIVE
339	69	27	55	6	NC_002950:PG0332|3end_transcription_termination_factor_Rho_367675..367825_POSITIVE
338	59	13	146	100	NC_002950:PG0962|3end_prolyl-tRNA_synthetase_1022327..1022477_NEGATIVE
336	50	5	75	32	NC_002950:PG1613|3end_glyoxalase_family_protein_1693164..1693314_NEGATIVE
335	49	2	145	76	NC_002950:PG1375|3end_hypothetical_protein_1456743..1456893_POSITIVE
334	77	33	65	12	NC_002950:PG0790|3end_GTP-binding_protein_Obg_841399..841549_NEGATIVE