Origin IGS:
attatggaataattatttatttcttttcggtcgcacaaaggtacgcgtttggctgtgatatacaaatgtcctgtccgaataaatatacgatatgtaatggttgatcgaaaacgtttcttctcttcttgcctccaatatccgatttacttgtcttctcttgagccgtcaggtagccgaaaagagag
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
ctctcttttcggctacctgacggctcaagagaagacaagtaaatcggatattggaggcaagaagagaagaaacgttttcgatcaaccattacatatcgtatatttattcggacaggacatttgtatatcacagccaaacgcgtacctttgtgcgaccgaaaagaaataaataattattccataat

Mask Tandem Repeat Region ================================================
attatggaataattatttatttcttttcggtcgcacaaaggtacgcgtttggctgtgatatacaaatgtcctgtccgaataaatatacgatatgtaatggttgatcgaaaacgtttcttctcttcttgcctccaatatccgatttacttgtcttctcttgagccgtcaggtagccgaaaagagag

Find is-nt database================================================
Query_seq: PG1430:PG1431|PG1430:PG1431:TPR domain protein:DNA-binding response regulator, LuxR family:<-<-:1515891..1516075 185
attatggaataattatttatttcttttcggtcgcacaaaggtacgcgtttggctgtgatatacaaatgtcctgtccgaataaatatacgatatgtaatggttgatcgaaaacgtttcttctcttcttgcctccaatatccgatttacttgtcttctcttgagccgtcaggtagccgaaaagagag
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PG1430:PG1431|PG1430:PG1431:TPR domain protein:DNA-binding response regulator, LuxR family:<-<-:1515891..1516075 185
attatggaataattatttatttcttttcggtcgcacaaaggtacgcgtttggctgtgatatacaaatgtcctgtccgaataaatatacgatatgtaatggttgatcgaaaacgtttcttctcttcttgcctccaatatccgatttacttgtcttctcttgagccgtcaggtagccgaaaagagag
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PG1430:PG1431|PG1430:PG1431:TPR domain protein:DNA-binding response regulator, LuxR family:<-<-:1515891..1516075 185
attatggaataattatttatttcttttcggtcgcacaaaggtacgcgtttggctgtgatatacaaatgtcctgtccgaataaatatacgatatgtaatggttgatcgaaaacgtttcttctcttcttgcctccaatatccgatttacttgtcttctcttgagccgtcaggtagccgaaaagagag
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

attatggaataattatttatttcttttcggtcgcacaaaggtacgcgtttggctgtgatatacaaatgtcctgtccgaataaatatacgatatgtaatggttgatcgaaaacgtttcttctcttcttgcctccaatatccgatttacttgtcttctcttgagccgtcaggtagccgaaaagagag
Predict ORF larger than 30AA ================================================
Protein_Len: 31	Strand: +	Start: 9	End: 101
........ M  I  I  Y  F  F  S  V  A  Q  R  Y  A  F  G  C  D  I  Q  M  S  C  P  N  K  Y  T  I  C  N  G ....................................................................................
Protein_Len: 55	Strand: +	Start: 19	End: 183
.................. M  S  F  R  S  H  K  G  T  R  L  A  V  I  Y  K  C  P  V  R  I  N  I  R  Y  V  M  V  D  R  K  R  F  F  S  S  C  L  Q  Y  P  I  Y  L  S  S  L  E  P  S  G  S  R  K  E ..
Protein_Len: 50	Strand: -	Start: 20	End: 169
................... K  K  E  T  A  C  L  Y  A  N  P  Q  S  I  C  I  D  Q  G  F  L  Y  V  I  H  L  P  Q  D  F  V  N  R  R  K  K  G  G  I  D  S  K  S  T  K  E  Q  A  T  M ................
Protein_Len: 41	Strand: -	Start: 16	End: 138
............... K  N  R  K  P  R  V  F  T  R  T  Q  S  H  Y  V  F  T  R  D  S  Y  I  Y  S  I  Y  H  N  I  S  F  T  E  E  R  R  A  E  L  M ...............................................
Protein_Len: 47	Strand: -	Start: 3	End: 143
.. I  S  Y  N  N  I  E  K  R  D  C  L  P  V  R  K  A  T  I  Y  L  H  G  T  R  I  F  I  R  Y  T  I  T  S  R  F  R  K  K  E  E  Q  R  W  Y  G  M ..........................................

attatggaataattatttatttcttttcggtcgcacaaaggtacgcgtttggctgtgatatacaaatgtcctgtccgaataaatatacgatatgtaatggttgatcgaaaacgtttcttctcttcttgcctccaatatccgatttacttgtcttctcttgagccgtcaggtagccgaaaagagag
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

attatggaataattatttatttcttttcggtcgcacaaaggtacgcgtttggctgtgatatacaaatgtcctgtccgaataaatatacgatatgtaatggttgatcgaaaacgtttcttctcttcttgcctccaatatccgatttacttgtcttctcttgagccgtcaggtagccgaaaagagag
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: PG1430:PG1431|PG1430:PG1431:TPR domain protein:DNA-binding response regulator, LuxR family:<-<-:1515891..1516075 185
attatggaataattatttatttcttttcggtcgcacaaaggtacgcgtttggctgtgatatacaaatgtcctgtccgaataaatatacgatatgtaatggttgatcgaaaacgtttcttctcttcttgcctccaatatccgatttacttgtcttctcttgagccgtcaggtagccgaaaagagag
Intra-Species Hit: Count: 1	Min: 1	Max: 185	Len: 185
Subject: NC_002950_PG1430_PG1431|TPR domain protein:DNA-binding response regulator, LuxR family|NEGATIVE:NEGATIVE|[1515891,1516075]|185
HSP  1	e-value: 1.0E-101	bit: 367.0	Len: 185	Query Start:1	Query End:185	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 185
attatggaataattatttatttcttttcggtcgcacaaaggtacgcgtttggctgtgatatacaaatgtcctgtccgaataaatatacgatatgtaatggttgatcgaaaacgtttcttctcttcttgcctccaatatccgatttacttgtcttctcttgagccgtcaggtagccgaaaagagag
attatggaataattatttatttcttttcggtcgcacaaaggtacgcgtttggctgtgatatacaaatgtcctgtccgaataaatatacgatatgtaatggttgatcgaaaacgtttcttctcttcttgcctccaatatccgatttacttgtcttctcttgagccgtcaggtagccgaaaagagag

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AUUAUGGAAUAAUUAUUUAUUUCUUUUCGGUCGCACAAAGGUACGCGUUUGGCUGUGAUAUACAAAUGUCCUGUCCGAAUAAAUAUACGAUAUGUAAUGGUUGAUCGAAAACGUUUCUUCUCUUCUUGCCUCCAAUAUCCGAUUUACUUGUCUUCUCUUGAGCCGUCAGGUAGCCGAAAAGAGAG
...................((((((((((((..(.....(((.(..(((((((.(.(((((....)))))).).))))))........(((((.....(((.((..(((........)))...))..)))....)))))....................).))).....)..)))))))))))). (-38.90)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
CUCUCUUUUCGGCUACCUGACGGCUCAAGAGAAGACAAGUAAAUCGGAUAUUGGAGGCAAGAAGAGAAGAAACGUUUUCGAUCAACCAUUACAUAUCGUAUAUUUAUUCGGACAGGACAUUUGUAUAUCACAGCCAAACGCGUACCUUUGUGCGACCGAAAAGAAAUAAAUAAUUAUUCCAUAAU
...(((((((((.........((((...((....((((((.....((..(((((((((...............)))))))))...))..(((.....)))..................))))))...))..)))).....(((((....))))).)))))))))..................... (-34.26)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
947	80	31	171	122	NC_002950:PG1430|5end_TPR_domain_protein_1515800..1516030_NEGATIVE
362	59	20	55	17	NC_002950:PG1496|5end_hypothetical_protein_1573342..1573572_POSITIVE
338	74	31	114	74	NC_002950:PG0092|5end_transporter,_putative_108598..108828_NEGATIVE
329	72	33	216	175	NC_002950:PG0854|5end_hypothetical_protein_914870..915100_POSITIVE
326	79	31	201	133	NC_002950:PG2029|5end_hypothetical_protein_2126543..2126773_POSITIVE
321	175	135	133	90	NC_002950:PG0259|5end_hypothetical_protein_292278..292508_POSITIVE
320	177	131	230	185	NC_002950:PG1003|5end_hypothetical_protein_1059232..1059462_POSITIVE
320	60	16	194	157	NC_002950:PG0963|5end_hypothetical_protein_1024332..1024562_NEGATIVE
320	54	16	200	155	NC_002950:PG0275|5end_thioredoxin_family_protein_307464..307694_NEGATIVE
311	178	131	202	152	NC_002950:PG1659|5end_hypothetical_protein_1743747..1743977_NEGATIVE
310	178	138	157	115	NC_002950:PG0203|5end_hypothetical_protein_240211..240441_NEGATIVE
308	143	104	197	152	NC_002950:PG1252|5end_hypothetical_protein_1329584..1329814_NEGATIVE
304	90	44	201	151	NC_002950:PG0159|5end_endopeptidase_PepO_183164..183394_NEGATIVE
302	56	22	192	153	NC_002950:PG1706|5end_hypothetical_protein_1794211..1794441_NEGATIVE
300	68	23	174	125	NC_002950:PG1823|5end_hypothetical_protein_1917317..1917547_POSITIVE
300	174	137	73	39	NC_002950:PG1082|5end_phosphotransacetylase_1150683..1150913_NEGATIVE
300	179	146	222	185	NC_002950:PG0003|5end_hypothetical_protein_2938..3168_NEGATIVE
299	142	101	173	126	NC_002950:PG1093|5end_hypothetical_protein_1158121..1158351_POSITIVE
296	169	125	42	5	NC_002950:PG1861|5end_hypothetical_protein_1960057..1960287_NEGATIVE
295	57	25	158	122	NC_002950:PG0595|5end_30S_ribosomal_protein_S6_653008..653238_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
362	59	20	49	11	NC_002950:PG1495|3end_DNA_topoisomerase_III_1573416..1573566_POSITIVE
338	74	31	69	29	NC_002950:PG0093|3end_HlyD_family_secretion_protein_108643..108793_NEGATIVE
321	175	135	126	83	NC_002950:PG0258|3end_ABC_transporter,_ATP-binding_protein_292351..292501_POSITIVE
320	54	16	62	17	NC_002950:PG0276|3end_hypothetical_protein_307602..307752_NEGATIVE
313	178	136	148	100	NC_002950:PG1223|3end_hypothetical_protein_1299744..1299894_POSITIVE
310	178	138	106	64	NC_002950:PG0204|3end_hypothetical_protein_240262..240412_NEGATIVE
309	55	16	76	35	NC_002950:PG0164|3end_hypothetical_protein_187081..187231_NEGATIVE
299	176	131	86	37	NC_002950:PG2125|3end_transcriptional_regulator,_AraC_family_2231376..2231526_NEGATIVE
299	142	101	64	17	NC_002950:PG1091|3end_DHH_subfamily_1_protein_1158092..1158242_POSITIVE
295	57	25	61	25	NC_002950:PG0594|3end_RNA_polymerase_sigma-70_factor_652991..653141_POSITIVE
291	63	27	44	1	NC_002950:PG0879|3end_hypothetical_protein_941931..942081_NEGATIVE
286	79	44	72	33	NC_002950:PG2048|3end_hypothetical_protein_2148134..2148284_NEGATIVE
283	78	41	150	117	NC_002950:PG0279|3end_NADP-dependent_malic_enzyme_310675..310825_NEGATIVE
282	58	20	103	68	NC_002950:PG2206|3end_ABC_transporter,_ATP-binding_protein_2317250..2317400_NEGATIVE
282	175	131	139	79	NC_002950:PG2024|3end_hemagglutinin_protein_HagE_2119083..2119233_NEGATIVE
282	46	1	73	26	NC_002950:PG1825|3end_hypothetical_protein_1919510..1919660_NEGATIVE
278	178	131	126	80	NC_002950:PG0415|3end_peptidyl-prolyl_cis-trans_isomerase,_PPIC-type_453714..453864_NEGATIVE
277	163	128	73	43	NC_002950:PG1133|3end_hypothetical_protein_1214103..1214253_POSITIVE
277	140	99	142	96	NC_002950:PG0773|3end_hypothetical_protein_825348..825498_POSITIVE
276	170	123	147	112	NC_002950:PG0004|3end_NAD-dependent_deacetylase_3752..3902_POSITIVE