Origin IGS:
actgccgctcggccatatctgtagcacgtactcggattcttgcattatagagaccttctcttttttcaaagggctcaatatgccttccgaatgagaaacgaaaagtggcacgtctttatattcggagaaaagggaaggaaaaagcaacatcccgcccactgagccagcggacgggatgtgtattggaatggtgtatgg
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
ccatacaccattccaatacacatcccgtccgctggctcagtgggcgggatgttgctttttccttcccttttctccgaatataaagacgtgccacttttcgtttctcattcggaaggcatattgagccctttgaaaaaagagaaggtctctataatgcaagaatccgagtacgtgctacagatatggccgagcggcagt

Mask Tandem Repeat Region ================================================
actgccgctcggccatatctgtagcacgtactcggattcttgcattatagagaccttctcttttttcaaagggctcaatatgccttccgaatgagaaacgaaaagtggcacgtctttatattcggagaaaagggaaggaaaaagcaacatcccgcccactgagccagcggacgggatgtgtattggaatggtgtatgg

Find is-nt database================================================
Query_seq: PG2146:PG2147|PG2146:PG2147:hypothetical protein:xanthine phosphoribosyltransferase:-><-:2254711..2254908 198
actgccgctcggccatatctgtagcacgtactcggattcttgcattatagagaccttctcttttttcaaagggctcaatatgccttccgaatgagaaacgaaaagtggcacgtctttatattcggagaaaagggaaggaaaaagcaacatcccgcccactgagccagcggacgggatgtgtattggaatggtgtatgg
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PG2146:PG2147|PG2146:PG2147:hypothetical protein:xanthine phosphoribosyltransferase:-><-:2254711..2254908 198
actgccgctcggccatatctgtagcacgtactcggattcttgcattatagagaccttctcttttttcaaagggctcaatatgccttccgaatgagaaacgaaaagtggcacgtctttatattcggagaaaagggaaggaaaaagcaacatcccgcccactgagccagcggacgggatgtgtattggaatggtgtatgg
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PG2146:PG2147|PG2146:PG2147:hypothetical protein:xanthine phosphoribosyltransferase:-><-:2254711..2254908 198
actgccgctcggccatatctgtagcacgtactcggattcttgcattatagagaccttctcttttttcaaagggctcaatatgccttccgaatgagaaacgaaaagtggcacgtctttatattcggagaaaagggaaggaaaaagcaacatcccgcccactgagccagcggacgggatgtgtattggaatggtgtatgg
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

actgccgctcggccatatctgtagcacgtactcggattcttgcattatagagaccttctcttttttcaaagggctcaatatgccttccgaatgagaaacgaaaagtggcacgtctttatattcggagaaaagggaaggaaaaagcaacatcccgcccactgagccagcggacgggatgtgtattggaatggtgtatgg
Predict ORF larger than 30AA ================================================
Protein_Len: 30	Strand: +	Start: 2	End: 91
. M  P  L  G  H  I  C  S  T  Y  S  D  S  C  I  I  E  T  F  S  F  F  K  G  L  N  M  P  S  E ...........................................................................................................
Protein_Len: 40	Strand: +	Start: 40	End: 159
....................................... M  H  Y  R  D  L  L  F  F  Q  R  A  Q  Y  A  F  R  M  R  N  E  K  W  H  V  F  I  F  G  E  K  G  R  K  K  Q  H  P  A  H .......................................
Protein_Len: 40	Strand: +	Start: 78	End: 197
............................................................................. M  C  L  P  N  E  K  R  K  V  A  R  L  Y  I  R  R  K  G  K  E  K  A  T  S  R  P  L  S  Q  R  T  G  C  V  L  E  W  C  M .
Protein_Len: 30	Strand: -	Start: 78	End: 167
............................................................................. Y  A  K  R  I  L  F  S  F  H  C  T  K  I  N  P  S  F  P  L  F  F  C  C  G  A  W  Q  A  M ...............................
Protein_Len: 60	Strand: -	Start: 1	End: 189
 P  W  I  Q  L  V  Y  E  S  E  Q  M  I  S  V  K  E  K  K  L  P  S  L  I  G  E  S  H  S  V  F  L  P  V  D  K  Y  E  S  F  L  S  P  F  L  L  M  G  G  V  S  G  A  S  P  I  H  I  P  M .........

actgccgctcggccatatctgtagcacgtactcggattcttgcattatagagaccttctcttttttcaaagggctcaatatgccttccgaatgagaaacgaaaagtggcacgtctttatattcggagaaaagggaaggaaaaagcaacatcccgcccactgagccagcggacgggatgtgtattggaatggtgtatgg
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

actgccgctcggccatatctgtagcacgtactcggattcttgcattatagagaccttctcttttttcaaagggctcaatatgccttccgaatgagaaacgaaaagtggcacgtctttatattcggagaaaagggaaggaaaaagcaacatcccgcccactgagccagcggacgggatgtgtattggaatggtgtatgg
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 82	HP_score: -5.4	Tail_Score: -5.00884	Start: 50	End: 60	Full_Region: GATTCTTGCATTATA GAGA CCT TCTC TTTTTTCAAAGGGCT
.................................................GAGACCTTCTC..........................................................................................................................................
TransTerm Strand: +	Conf: 100	HP_score: -15.4	Tail_Score: -3.09289	Start: 148	End: 178	Full_Region: GGAAGGAAAAAGCAA CATCCCGCCCACTG AGC CAGCGGACGGGATG TGTATTGGAATGGTG
...................................................................................................................................................CATCCCGCCCACTGAGCCAGCGGACGGGATG....................
TransTerm Strand: +	Conf: 82	HP_score: -12.2	Tail_Score: -3.10245	Start: 150	End: 176	Full_Region: AAGGAAAAAGCAACA TCCCGCCCACTG AGC CAGCGGACGGGA TGTGTATTGGAATGG
.....................................................................................................................................................TCCCGCCCACTGAGCCAGCGGACGGGA......................

Find igs database================================================
Query_seq: PG2146:PG2147|PG2146:PG2147:hypothetical protein:xanthine phosphoribosyltransferase:-><-:2254711..2254908 198
actgccgctcggccatatctgtagcacgtactcggattcttgcattatagagaccttctcttttttcaaagggctcaatatgccttccgaatgagaaacgaaaagtggcacgtctttatattcggagaaaagggaaggaaaaagcaacatcccgcccactgagccagcggacgggatgtgtattggaatggtgtatgg
Intra-Species Hit: Count: 1	Min: 1	Max: 198	Len: 198
Subject: NC_002950_PG2146_PG2147|hypothetical protein:xanthine phosphoribosyltransferase|POSITIVE:NEGATIVE|[2254711, 2254908]|198
HSP  1	e-value: 1.0E-108	bit: 392.0	Len: 198	Query Start:1	Query End:198	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 198
actgccgctcggccatatctgtagcacgtactcggattcttgcattatagagaccttctcttttttcaaagggctcaatatgccttccgaatgagaaacgaaaagtggcacgtctttatattcggagaaaagggaaggaaaaagcaacatcccgcccactgagccagcggacgggatgtgtattggaatggtgtatgg
actgccgctcggccatatctgtagcacgtactcggattcttgcattatagagaccttctcttttttcaaagggctcaatatgccttccgaatgagaaacgaaaagtggcacgtctttatattcggagaaaagggaaggaaaaagcaacatcccgcccactgagccagcggacgggatgtgtattggaatggtgtatgg

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
ACUGCCGCUCGGCCAUAUCUGUAGCACGUACUCGGAUUCUUGCAUUAUAGAGACCUUCUCUUUUUUCAAAGGGCUCAAUAUGCCUUCCGAAUGAGAAACGAAAAGUGGCACGUCUUUAUAUUCGGAGAAAAGGGAAGGAAAAAGCAACAUCCCGCCCACUGAGCCAGCGGACGGGAUGUGUAUUGGAAUGGUGUAUGG
...(((....)))...(((((.((......)))))))...((((((((.....((((((((((((((..(((((.......))))).(((((((((.(((..........))).))).)))))))))))))))))))).....(((.(((((((.((.(((...))).)).))))))))))......))))))))... (-63.20)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
CCAUACACCAUUCCAAUACACAUCCCGUCCGCUGGCUCAGUGGGCGGGAUGUUGCUUUUUCCUUCCCUUUUCUCCGAAUAUAAAGACGUGCCACUUUUCGUUUCUCAUUCGGAAGGCAUAUUGAGCCCUUUGAAAAAAGAGAAGGUCUCUAUAAUGCAAGAAUCCGAGUACGUGCUACAGAUAUGGCCGAGCGGCAGU
.....(((...........(((((((((((((((...)))))))))))))))(((((.(((...........(((((((....(((((..........)))))...)))))))..((((((.(((.(((((.........))))).))).)).))))..)))...))))).)))...........(((....)))... (-57.90)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
405	180	131	217	170	NC_002950:PG0526|5end_putative_inner_membrane_protein_translocase_component_YidC_570746..570976_POSITIVE
386	181	149	86	41	NC_002950:PG0480|5end_precorrin-2_C20-methyltransferase,_putative_521319..521549_NEGATIVE
360	175	131	205	153	NC_002950:PG2027|5end_hypothetical_protein_2125494..2125724_POSITIVE
359	186	148	167	109	NC_002950:PG1333|5end_hypothetical_protein_1415425..1415655_NEGATIVE
355	43	2	78	30	NC_002950:PG1441|5end_lysozyme-related_protein_1527525..1527755_NEGATIVE
352	50	2	199	145	NC_002950:PG1185|5end_hypothetical_protein_1267752..1267982_NEGATIVE
347	190	147	227	173	NC_002950:PG1394|5end_hypothetical_protein_1476782..1477012_NEGATIVE
347	178	144	62	21	NC_002950:PG0171|5end_5'-nucleotidase_family_protein_191724..191954_POSITIVE
345	187	142	68	6	NC_002950:PG0575|5end_penicillin-binding_protein_2,_putative_629501..629731_POSITIVE
344	145	106	78	30	NC_002950:PG1711|5end_alpha-1,2-mannosidase_family_protein_1798913..1799143_NEGATIVE
340	188	143	134	86	NC_002950:PG1402|5end_AP_endonuclease_domain_protein_1485963..1486193_NEGATIVE
336	180	142	165	117	NC_002950:PG1966|5end_hypothetical_protein_2056924..2057154_NEGATIVE
335	176	133	227	186	NC_002950:PG0985|5end_RNA_polymerase_sigma-70_factor,_ECF_subfamily_1046930..1047160_POSITIVE
334	140	94	85	39	NC_002950:PG1897|5end_thiamin_pyrophosphokinase_catalytic_domain_protein_1996730..1996960_NEGATIVE
333	180	133	128	79	NC_002950:PG0199|5end_TatD_family_protein_238137..238367_NEGATIVE
331	45	3	218	179	NC_002950:PG0359|5end_flavin_reductase_domain_protein_392851..393081_POSITIVE
330	182	150	231	185	NC_002950:PG1671|5end_hypothetical_protein_1757658..1757888_NEGATIVE
330	182	150	231	185	NC_002950:PG1266|5end_hypothetical_protein_1346987..1347217_NEGATIVE
330	182	150	231	185	NC_002950:PG0101|5end_hypothetical_protein_119198..119428_POSITIVE
328	43	3	199	157	NC_002950:PG1875|5end_hemolysin_1970621..1970851_NEGATIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
405	180	131	89	42	NC_002950:PG0525|3end_CTP_synthetase_570698..570848_POSITIVE
358	169	122	99	45	NC_002950:PG0143|3end_hydrolase,_carbon-nitrogen_family_165747..165897_NEGATIVE
344	117	71	135	78	NC_002950:PG0656|3end_50S_ribosomal_protein_L34_706945..707095_NEGATIVE
337	180	143	48	6	NC_002950:PG1393|3end_penicillin-binding_protein_2,_putative_1474406..1474556_NEGATIVE
335	187	148	58	7	NC_002950:PG0574|3end_hypothetical_protein_629571..629721_POSITIVE
334	140	94	88	42	NC_002950:PG1898|3end_transporter,_putative_1996727..1996877_NEGATIVE
333	175	144	145	104	NC_002950:PG1786|3end_hypothetical_protein_1875322..1875472_POSITIVE
333	180	133	144	95	NC_002950:PG0200|3end_hypothetical_protein_238121..238271_NEGATIVE
328	188	146	55	4	NC_002950:PG0027|3end_hypothetical_protein_33936..34086_POSITIVE
325	50	1	115	57	NC_002950:PG0507|3end_hypothetical_protein_548190..548340_POSITIVE
324	43	2	122	76	NC_002950:PG1675|3end_hypothetical_protein_1760360..1760510_POSITIVE
323	126	88	66	32	NC_002950:PG2076|3end_hypothetical_protein_2177073..2177223_POSITIVE
321	177	131	59	13	NC_002950:PG1348|3end_conserved_hypothetical_protein_TIGR00147_1429569..1429719_POSITIVE
316	34	1	53	17	NC_002950:PG2190|3end_cell-division_ATP-binding_protein_2297169..2297319_NEGATIVE
314	180	132	76	35	NC_002950:PG1782|3end_hypothetical_protein_1871961..1872111_POSITIVE
314	174	133	62	11	NC_002950:PG0211|3end_cobalamin_biosynthesis_protein_CbiG/precorrin-4_C11-methyltransferase_245966..246116_NEGATIVE
312	180	131	129	62	NC_002950:PG1391|3end_hypothetical_protein_1472961..1473111_POSITIVE
311	36	3	150	114	NC_002950:PG1334|3end_band_7/Mec-2_family_protein_1415422..1415572_NEGATIVE
311	43	2	59	9	NC_002950:PG1133|3end_hypothetical_protein_1214103..1214253_POSITIVE
310	160	111	108	59	NC_002950:PG1494|3end_hypothetical_protein_1571234..1571384_POSITIVE