CDS GC%: 27% tRNA GC%: 55.5% rRNA GC%: 48.1%

IGS#	Up stream Locus	Up stream Product	Down Stream Locus	Down Stream Product	Gene Dir type	Start	End	IGS Len	GC%	IS NT	IS AA	NR	PT-Pair	Intra Spp. IGS	Inter Spp. IGS	Conserved Inter-spp IGS Start	Conserved Inter-spp IGS End	Blast Result	Conserved IGS Seq
1	FN1496	Rod shape-determining protein mreC	FN1497	Multidrug resistance protein 2	<-<-	710	1103	394	20.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
2	FN1497	Multidrug resistance protein 2	FN1498	Integral membrane protein	<-->	2229	2702	474	28.1%	0	0	0	+: 1/1/0 \| -: 0/0/0	2	5	269	373	Result	cttcggggcagggtgaaattcccgaccggtggtatagtccacgaaagtatttgctttgatttggtgaaattccaaaaccgacagtagagtctggatgagagaaga
3	FN1498	Integral membrane protein	FN1499	Cell surface protein	->->	3603	3786	184	21.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
4	FN1504	Nickel-binding protein	FN1505	6,7-dimethyl-8-ribityllumazine synthase	<-->	10106	10535	430	24.2%	0	0	0	+: 1/2/0 \| -: 1/0/0	2	6	245	351	Result	gtcttcagggcagggtgaaattcccgaccggtggtacagtccacgaaagcatttgctttgatttggtgaaattccaaaaccgacagtagagtctggatgggagaaga
6	FN1513	Phophatidylinositol-4-phosphate 5-kinase	FN1514	Phophatidylinositol-4-phosphate 5-kinase	->->	17363	17515	153	17.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
8	FN1525	Dipeptide transport ATP-binding protein dppF	FN1526	Fusobacterium outer membrane protein family	-><-	31692	31841	150	23.3%	0	0	0	+: 2/0/0 \| -: 0/1/0	1	0	0	0	Result
9	FN1526	Fusobacterium outer membrane protein family	FN1527	hypothetical protein	<-<-	38274	42272	3999	31.6%	0	0	32	+: 5/3/11 \| -: 3/1/3	1	0	0	0	Result
14	FN1546	translation elongation factor EF-G	FN1547	PTS permease for N-acetylglucosamine and glucose	<-<-	61692	61890	199	22.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
15	FN1547	PTS permease for N-acetylglucosamine and glucose	FN1548	hypothetical protein	<-->	63361	63593	233	15.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
16	FN1553	Transporter	FN1554	Fusobacterium outer membrane protein family	<-<-	68629	68808	180	20.6%	0	0	0	+: 1/1/0 \| -: 1/1/1	1	0	0	0	Result
17	FN1554	Fusobacterium outer membrane protein family	FN1555	Protein Translation Elongation Factor Tu	<-<-	73558	76341	2784	30.2%	0	0	2	+: 4/4/6 \| -: 5/6/16	1	0	0	0	Result
18	FN1558	30S ribosomal protein S12	FN1559	cell volume regulation protein CvrA	<-->	80609	80966	358	17.9%	0	0	0	+: 1/1/1 \| -: 1/0/0	1	0	0	0	Result
20	FN1581	DNA mismatch repair protein mutS	FN1582	hypothetical protein	<-<-	93322	93676	355	20%	0	0	0	+: 0/1/0 \| -: 1/1/1	1	0	0	0	Result
21	FN1586	O-succinylbenzoate-CoA synthase	FN1587	Acetyltransferase	<-->	98633	98980	348	22.7%	0	0	0	+: 3/1/0 \| -: 0/0/0	1	0	0	0	Result
22	FN1587	Acetyltransferase	FN1588	hypothetical protein	->->	99395	99695	301	20.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
23	FN1590	Hypothetical lipoprotein	FN1591	RNFB-related protein	<-<-	101895	102067	173	16.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
26	FN1599	hypothetical protein	FN1600	tRNA pseudouridine synthase A	<-<-	108874	109158	285	19.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
27	FN1601	Hypothetical cytosolic protein	FN1602	Hypothetical cytosolic protein	<-<-	110999	111111	113	21.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
28	FN1602	Hypothetical cytosolic protein	FN1603	2',3'-cyclic nucleotide 3'-phosphodiesterase	<-<-	111583	111699	117	25.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
29	FN1604	hypothetical protein	FN1605	Adenylosuccinate synthetase	<-<-	113913	114088	176	27.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
30	FN1609	hypothetical protein	FN1610	33 kDa chaperonin	<-<-	119704	119829	126	22.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
31	FN1614	MG(2+) chelatase family protein	FN1615	Integral membrane protein	<-->	125093	125264	172	23.8%	0	0	0	+: 2/3/3 \| -: 0/3/0	1	0	0	0	Result
32	FN1615	Integral membrane protein	FN1616	transcription antitermination protein NusB	-><-	125817	126065	249	21.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
33	FN1619	Hypothetical cytosolic protein	FN1620	30S ribosomal protein S2	<-->	127735	128035	301	22.6%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
35	FN1645	LSU ribosomal protein L3P	FN1646	SSU ribosomal protein S10P	<-<-	141392	141538	147	27.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
37	FN1651	Oligopeptide transport system permease protein oppB	FN1652	Oligopeptide-binding protein oppA	<-<-	145890	146130	241	27%	0	0	1	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
38	FN1652	Oligopeptide-binding protein oppA	FN1653	Na+ driven multidrug efflux pump	<-<-	147631	147741	111	16.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
40	FN1658	prolyl-tRNA synthetase	FN1659	hypothetical protein	<-->	154982	155175	194	17.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
42	FN1663	hypothetical protein	FN1664	hypothetical protein	<-->	161825	162254	430	18.1%	0	0	0	+: 3/0/0 \| -: 1/1/0	1	0	0	0	Result
44	FN1670	Choline kinase	FN1671	ABC transporter ATP-binding protein	<-<-	168357	168572	216	22.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
45	FN1672	Membrane-bound O-acyltransferase	FN1673	hypothetical protein	<-<-	171384	171762	379	19.3%	0	0	1	+: 1/1/0 \| -: 3/1/0	1	0	0	0	Result
52	FN1681	hypothetical protein	FN1682	Heteropolysaccharide repeat unit export protein	<-<-	176653	177152	500	23.4%	0	106	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
54	FN1690	hypothetical protein	FN1691	Hypothetical membrane-spanning protein	<-<-	186480	186721	242	23.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
57	FN1703	ADP-L-glycero-D-manno-heptose-6-epimerase	FN1704	Serine protease	<-->	199083	199274	192	15.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
58	FN1713	tRNA (Uracil-5-) -methyltransferase	FN1714	hypothetical protein	->->	209029	210115	1087	26%	0	0	0	+: 1/0/0 \| -: 2/2/4	1	0	0	0	Result
62	FN1731	Anthranilate synthase component II	FN1732	hypothetical protein	<-<-	231128	231370	243	25.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
63	FN1732	hypothetical protein	FN1733	ATP synthase subunit D	<-<-	232169	232325	157	19.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
64	FN1740	ATP synthase subunit K	FN1741	ATP synthase subunit I	<-<-	238491	238650	160	29.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
66	FN1743	Multidrug-efflux transporter 2 regulator	FN1744	Transporter	<-<-	241929	242128	200	15%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
67	FN1745	Cystathionine gamma-synthase	FN1746	Cystathionine beta-lyase	<-->	244234	244480	247	15.4%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
72	FN1763	Hypothetical cytosolic protein	FN1764	Enolase	<-<-	256653	256782	130	26.2%	0	0	0	+: 0/1/0 \| -: 2/0/0	1	0	0	0	Result
74	FN1782	Phosphocarrier protein HPr	FN1783	Ethanolamine utilization protein eutJ	<-->	264581	264765	185	14.1%	0	0	0	+: 1/1/0 \| -: 1/0/0	1	0	0	0	Result
75	FN1783	Ethanolamine utilization protein eutJ	FN1784	hypothetical protein	-><-	265591	265824	234	18.4%	0	0	0	+: 3/1/0 \| -: 0/0/0	1	0	0	0	Result
77	FN1792	hypothetical protein	FN1793	Phosphoenolpyruvate-protein phosphotransferase	<-<-	273355	273623	269	22.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
79	FN1795	hypothetical protein	FN1796	hypothetical protein	<-->	276669	278615	1947	25.2%	0	0	0	+: 4/0/0 \| -: 3/1/0	1	0	0	0	Result
80	FN1796	hypothetical protein	FN1797	Spermidine/putrescine transport ATP-binding protein potA	->->	278856	278960	105	21%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
81	FN1800	Peptidyl-prolyl cis-trans isomerase	FN1801	Sodium/glutamate symport carrier protein	-><-	282595	282725	131	22.9%	0	0	0	+: 1/1/0 \| -: 0/2/0	1	0	0	0	Result
84	FN1805	hypothetical protein	FN1806	Integral membrane protein	->->	287760	287863	104	20.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
85	FN1808	hypothetical protein	FN1809	Iron/zinc/copper-binding protein	<-<-	289996	290269	274	24.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	4	0	0	0	Result
86	FN1810	Manganese transport system membrane protein mntB	FN1811	Manganese transport system ATP-binding protein mntA	<-<-	292044	292250	207	29.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	7	0	0	0	Result
89	FN1818	Hemolysin activator protein precursor	FN1819	Export ABC transporter	<-->	307046	307658	613	19.4%	0	0	1	+: 2/4/0 \| -: 2/2/2	9	0	0	0	Result
91	FN1825	hypothetical protein	FN1826	Protease	-><-	314572	314743	172	22.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
92	FN1833	Biopolymer transport exbD protein	FN1834	Biopolymer transport exbB protein	<-<-	322657	322765	109	26.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
94	FN1837	putative nucleotide-binding protein	FN1838	Glycerol uptake facilitator protein	<-->	327346	327628	283	18.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
96	FN1851	Ribonuclease PH	FN1852	hypothetical protein	->->	341624	341755	132	13.6%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
97	FN1852	hypothetical protein	FN1853	methylaspartate mutase subunit S	->->	342137	342256	120	19.2%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
98	FN1858	Short-chain fatty acids transporter	FN1859	Major outer membrane protein	<-<-	348363	348638	276	18.1%	0	0	0	+: 0/2/0 \| -: 1/1/1	1	0	0	0	Result
100	FN1860	NA+/H+ antiporter NHAC	FN1861	L-lysine permease	<-<-	351568	351774	207	16.9%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
101	FN1866	Lysine 2,3-aminomutase	FN1867	Zn-dependent alcohol dehydrogenase and related dehydrogenase	<-<-	358531	358649	119	21%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
102	FN1869	hypothetical protein	FN1870	hypothetical protein	<-<-	360930	361543	614	21%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
103	FN1870	hypothetical protein	FN1871	hypothetical protein	<-<-	362273	362386	114	21.1%	0	0	0	+: 1/4/0 \| -: 1/0/0	1	0	0	0	Result
104	FN1871	hypothetical protein	FN1872	hypothetical protein	<-<-	362642	362878	237	18.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
111	FN1884	hypothetical protein	FN1885	Hemolysin III	<-->	370598	370823	226	17.3%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
113	FN1890	hypothetical protein	FN1891	Glycerophosphoryl diester phosphodiesterase	<-<-	373312	373598	287	21.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
114	FN1891	Glycerophosphoryl diester phosphodiesterase	FN1893	Fusobacterium outer membrane protein family	<-<-	374385	374501	117	20.5%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
115	FN1892	hypothetical protein	FN1894	BAX protein	-><-	377971	381820	3850	31.5%	0	0	106	+: 6/4/11 \| -: 2/3/2	1	0	0	0	Result
116	FN1894	BAX protein	FN1895	hypothetical protein	<-<-	382433	382631	199	23.6%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
117	FN1898	Sugar transport ATP-binding protein	FN1899	Hypothetical lipoprotein	<-<-	386660	386803	144	26.4%	0	0	0	+: 0/2/0 \| -: 1/1/0	1	0	0	0	Result
118	FN1899	Hypothetical lipoprotein	FN1900	pfoS/R	<-->	388055	388383	329	14.6%	0	0	0	+: 1/1/0 \| -: 1/1/1	1	0	0	0	Result
119	FN1902	Deoxycytidylate deaminase	FN1903	Coenzyme A disulfide reductase/ disulfide bond regulator domain	<-<-	390642	390761	120	20%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
120	FN1905	168 kDa surface-layer protein precursor	FN1906	Cytosol aminopeptidase	<-->	398207	398506	300	17.7%	0	0	0	+: 3/0/0 \| -: 0/0/0	1	0	0	0	Result
122	FN1912	hypothetical protein	FN1913	hydrolase (HD superfamily)	<-<-	409036	410143	1108	22.3%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
123	FN1916	hypothetical protein	FN1917	tRNA delta(2)-isopentenylpyrophosphate transferase	<-<-	412787	412934	148	17.6%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
125	FN1922	hypothetical protein	FN1923	Adenine-specific methyltransferase	<-<-	419526	419696	171	25.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
127	FN1926	Nitrogen regulatory IIA protein	FN1927	DEGV protein	<-<-	425378	425504	127	19.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
128	FN1933	hypothetical protein	FN1934	hypothetical protein	<-<-	434134	434355	222	17.1%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
131	FN1940	Na+ driven multidrug efflux pump	FN1941	ClpB protein	<-->	441046	441418	373	18.5%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
132	FN1942	Hypothetical cytosolic protein	FN1943	Tryptophanase	<-->	444780	444990	211	21.3%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
136	FN1950	Serine protease	FN1951	ATPase associated with chromosome architecture/replication	<-<-	457946	458489	544	25.6%	0	0	1	+: 0/2/0 \| -: 1/3/0	1	0	0	0	Result
142	FN1971	Hemin receptor	FN1972	hypothetical protein	<-<-	471197	471792	596	28.2%	0	0	0	+: 3/1/0 \| -: 3/1/0	1	0	0	0	Result
143	FN1972	hypothetical protein	FN1973	Translation initiation inhibitor	<-<-	472162	472319	158	24.7%	0	0	0	+: 0/3/0 \| -: 1/1/1	1	0	0	0	Result
145	FN1978	Cell division protein ftsH	FN1979	SSU ribosomal protein S15P	->->	481764	481875	112	24.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
148	FN1982	hypothetical protein	FN1983	Alkyl hydroperoxide reductase C22 protein	->->	484633	484758	126	14.3%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
149	FN1983	Alkyl hydroperoxide reductase C22 protein	FN1984	Glutaredoxin-like protein	->->	485326	485626	301	24.6%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
150	FN1985	Inner membrane protein	FN1986	hypothetical protein	<-->	488728	489056	329	25.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
151	FN1987	Transcriptional regulator, GntR family	FN1988	Tyrosine phenol-lyase	<-->	490759	491057	299	16.4%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
152	FN1988	Tyrosine phenol-lyase	FN1989	Sodium-dependent tyrosine transporter	->->	492441	492570	130	23.8%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
153	FN1989	Sodium-dependent tyrosine transporter	FN1990	Tetratricopeptide repeat protein	->->	493888	494224	337	18.7%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
154	FN1994	hypothetical protein	FN1995	hypothetical protein	->->	498152	498384	233	30%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
155	FN2002	Permease	FN2003	bioY protein	<-->	503654	503884	231	23.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
158	FN2010	Transcriptional regulator, MarR family	FN2011	Valyl-tRNA synthetase	<-<-	510393	510522	130	22.3%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
159	FN2012	hypothetical protein	FN2013	GTP-binding protein	<-<-	513990	514157	168	28.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
160	FN2016	ATP-dependent Clp protease proteolytic subunit	FN2017	Trigger factor, ppiase	<-<-	518939	519041	103	29.1%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
166	FN2036	DNA-directed RNA polymerase beta chain	FN2037	LSU ribosomal protein L12P (L7/L12)	<-<-	546462	546858	397	25.4%	0	0	3	+: 3/1/1 \| -: 0/0/0	1	0	0	0	Result
167	FN2038	LSU ribosomal protein L10P	FN2039	50S ribosomal protein L1	<-<-	547787	547939	153	35.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
168	FN2044	LSU ribosomal protein L33P	FN2045	Ferric uptake regulation protein	<-<-	550200	550463	264	28.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
171	FN2047	Fusobacterium outer membrane protein family	FN2048	Outer membrane protein	<-<-	556474	558890	2417	32.7%	0	0	6	+: 2/1/2 \| -: 0/0/0	3	0	0	0	Result
172	FN2052	hypothetical protein	FN2053	Serine/threonine sodium symporter	<-<-	561034	561317	284	21.5%	0	0	0	+: 0/0/0 \| -: 1/1/1	1	0	0	0	Result
175	FN2058	Fusobacterium outer membrane protein family	FN2059	Outer membrane protein	<-<-	571186	572966	1781	32.5%	0	0	5	+: 3/1/2 \| -: 1/1/1	3	0	0	0	Result
176	FN2063	hypothetical protein	FN2064	hypothetical protein	<-<-	575110	575302	193	18.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
178	FN2066	hypothetical protein	FN2067	Thiol:disulfide interchange protein tlpA	-><-	576834	576973	140	25%	0	0	0	+: 1/0/0 \| -: 0/2/0	1	0	0	0	Result
179	FN2069	Amino acid carrier protein alsT	FN2070	Cobyric acid synthase	<-<-	580468	580593	126	17.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
183	FN2075	hypothetical protein	FN2076	MunI regulatory protein	<-<-	587460	587625	166	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
185	FN2080	ABC transporter integral membrane protein	FN2081	ABC transporter substrate-binding protein	<-<-	592048	592164	117	23.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
186	FN2081	ABC transporter substrate-binding protein	FN2082	Formate--tetrahydrofolate ligase	<-<-	593065	593346	282	19.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
189	FN2085	hypothetical protein	FN2086	General secretion pathway protein D	<-<-	597136	597596	461	20.8%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
190	FN2086	General secretion pathway protein D	FN2087	hypothetical protein	<-<-	598806	599128	323	23.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
192	FN2091	hypothetical protein	FN2092	Integral membrane protein	<-<-	602572	602703	132	26.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
193	FN2093	General secretion pathway protein G	FN2094	General secretion pathway protein F	<-<-	603642	603888	247	27.5%	0	0	0	+: 1/1/1 \| -: 0/1/0	2	0	0	0	Result
194	FN2095	General secretion pathway protein E	FN2096	hypothetical protein	<-<-	606171	606356	186	29%	0	0	0	+: 0/0/0 \| -: 0/0/0	16	0	0	0	Result
195	FN2097	hypothetical protein	FN2098	MRP-family nucleotide-binding protein	<-<-	606944	607462	519	20%	0	0	0	+: 0/4/0 \| -: 1/3/0	1	0	0	0	Result
198	FN2102	ABC transporter ATP-binding protein	FN2103	RecA protein	->->	613213	613342	130	19.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
199	FN2103	RecA protein	FN2104	hypothetical protein	->->	614270	614376	107	24.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
202	FN2110	Hypothetical exported 24-amino acid repeat protein	FN2111	Hypothetical exported 24-amino acid repeat protein	<-<-	622421	622523	103	28.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
203	FN2114	hypothetical protein	FN2115	hypothetical protein	<-<-	624298	624477	180	20.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
204	FN2115	hypothetical protein	FN2116	Hypothetical exported 24-amino acid repeat protein	<-<-	624934	625087	154	22.1%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
205	FN2119	Hypothetical exported 24-amino acid repeat protein	FN2120	Hypothetical exported 24-amino acid repeat protein	<-<-	628143	628450	308	17.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
206	FN2120	Hypothetical exported 24-amino acid repeat protein	FN2121	Hypothetical exported 24-amino acid repeat protein	<-<-	629021	629125	105	26.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
207	FN2125	DNA gyrase subunit A	FN2126	DNA gyrase subunit B	<-<-	636251	636395	145	20%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
208	FN0001	Chromosomal replication initiator protein dnaA	FN0002	Ribonuclease P protein component	<-->	641869	642687	819	16.2%	0	0	1	+: 1/1/0 \| -: 2/1/1	1	0	0	0	Result
210	FN0007	glucose-inhibited division protein A	FN0008	quinolinate synthetase	->->	647965	648149	185	21.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
214	FN0016	hypothetical protein	FN0017	hypothetical protein	->->	654427	654769	343	20.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
218	FN0023	Short-chain fatty acids transporter	FN0024	Hypothetical exported 24-amino acid repeat protein	->->	662841	663190	350	17.1%	0	0	0	+: 2/1/2 \| -: 0/1/0	1	0	0	0	Result
222	FN0032	hypothetical protein	FN0033	hypothetical protein	<-<-	669869	670235	367	25.3%	0	0	0	+: 0/1/0 \| -: 2/1/1	1	0	0	0	Result
223	FN0033	hypothetical protein	FN0034	hypothetical protein	<-<-	675060	675528	469	22.8%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
224	FN0034	hypothetical protein	FN0035	hypothetical protein	<-<-	676180	676329	150	18%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
225	FN0037	hypothetical protein	FN0038	hypothetical protein	<-<-	678152	678286	135	22.2%	0	0	0	+: 0/2/0 \| -: 1/0/0	1	0	0	0	Result
226	FN0038	hypothetical protein	FN0039	DNA primase (bacterial type) and small primase-like proteins	<-<-	678590	678750	161	21.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
227	FN0042	Rod shape-determining protein rodA	FN0043	Hypothetical exported 24-amino acid repeat protein	<-->	682220	682401	182	19.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
228	FN0046	3-dehydroquinate dehydratase	FN0047	Exodeoxyribonuclease III	->->	684326	684566	241	26.6%	0	0	1	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
229	FN0048	4-nitrophenylphosphatase	FN0049	hypothetical protein	<-->	686134	686490	357	20.7%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
230	FN0049	hypothetical protein	FN0050	Fumarate reductase flavoprotein subunit	->->	686980	687182	203	19.7%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
231	FN0052	Arsenate reductase	FN0053	Branched-chain amino acid transport system carrier protein	->->	689352	689479	128	25.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
232	FN0053	Branched-chain amino acid transport system carrier protein	FN0054	tyrosyl-tRNA synthetase	->->	690755	690975	221	26.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
233	FN0054	tyrosyl-tRNA synthetase	FN0055	Ribosomal-protein-alanine acetyltransferase	->->	692197	692297	101	24.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
234	FN0059	NifU protein	FN0060	D-alanyl-D-alanine carboxypeptidase	->->	695680	695913	234	24.8%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
236	FN0063	hypothetical protein	FN0064	Hypothetical cytosolic protein	->->	699455	699628	174	20.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
237	FN0065	Transcription accessory protein (S1 RNA binding domain)	FN0066	Two component system histidine kinase	->->	702245	702466	222	30.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
239	FN0071	GTP cyclohydrolase I	FN0072	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase	->->	711666	711854	189	31.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	2	0	0	0	Result
240	FN0077	Ethanolamine two-component sensor kinase	FN0078	Ethanolamine utilization protein eutA	->->	716233	716344	112	26.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
241	FN0080	ethanolamine ammonia-lyase small subunit	FN0081	Ethanolamine utilization protein eutL	->->	720069	720174	106	21.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
242	FN0083	Ethanolamine utilization protein eutM precursor	FN0084	Acetaldehyde dehydrogenase [acetylating]	->->	721605	721711	107	33.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
243	FN0084	Acetaldehyde dehydrogenase [acetylating]	FN0085	Ethanolamine utilization cobalamin adenosyltransferase	->->	723155	723409	255	29%	0	0	1	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
247	FN0100	Flavodoxins/hemoproteins	FN0101	Glutaredoxin	<-->	735857	736169	313	15.3%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
248	FN0104	Acetyltransferase	FN0105	Hypothetical cytosolic protein	<-->	739987	740346	360	25.6%	0	0	1	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
250	FN0106	hypothetical protein	FN0107	Sodium/proline symporter	->->	741523	741851	329	22.5%	0	0	0	+: 1/2/0 \| -: 1/0/0	1	0	0	0	Result
251	FN0116	Chaperone protein dnaK	FN0117	O6-methylguanine-DNA methyltransferase	->->	750217	750477	261	28%	0	0	0	+: 0/0/0 \| -: 0/0/0	9	0	0	0	Result
252	FN0119	Flavodoxin	FN0120	hypothetical protein	-><-	752708	752807	100	22%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
255	FN0127	Fe-S oxidoreductase	FN0128	Spermidine/putrescine-binding protein	<-->	756403	756790	388	24.7%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
256	FN0129	Urease accessory protein ureG	FN0130	ABC transporter ATP-binding protein	->->	758431	758725	295	28.8%	0	0	3	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
264	FN0142	hypothetical protein	FN0143	hypothetical protein	->->	773898	774036	139	23%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
265	FN0146	hypothetical protein	FN0147	fatty acid/phospholipid synthesis protein	->->	775391	775601	211	16.6%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
266	FN0160	hypothetical protein	FN0161	RNA-directed DNA polymerase	->->	788659	788902	244	29.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
267	FN0161	RNA-directed DNA polymerase	FN0162	Na+ driven multidrug efflux pump	->->	789953	790063	111	18%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
268	FN0164	Anhydro-N-acetylmuramyl-tripeptide amidase	FN0165	hypothetical protein	->->	793352	793630	279	19%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
270	FN0171	Hypothetical cytosolic protein	FN0172	RNA binding protein	->->	796982	797139	158	25.3%	0	0	0	+: 1/1/0 \| -: 1/0/0	1	0	0	0	Result
271	FN0172	RNA binding protein	FN0173	hypothetical protein	->->	797866	797978	113	23%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
272	FN0173	hypothetical protein	FN0174	Enoyl-[acyl-carrier-protein] reductase	->->	799365	799566	202	27.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
276	FN0185	hypothetical protein	FN0186	Cytochrome c-type biogenesis protein ccdA	<-->	810560	810992	433	21%	0	0	0	+: 2/1/0 \| -: 1/1/1	1	0	0	0	Result
277	FN0190	Two-component sensor kinase yesM	FN0191	ATP-dependent DNA helicase recG	->->	815774	815891	118	18.6%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
278	FN0191	ATP-dependent DNA helicase recG	FN0192	Dipeptide-binding protein	->->	817326	817481	156	17.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
279	FN0197	Methyltransferase	FN0198	Transcriptional regulatory protein	->->	823605	823900	296	18.6%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
280	FN0201	Glutaconyl-COA decarboxylase beta subunit	FN0202	Glutaconate CoA-transferase subunit A	->->	827810	827919	110	20.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
281	FN0204	Glutaconyl-CoA decarboxylase A subunit	FN0205	Sodium/glutamate symport carrier protein	->->	831467	831608	142	18.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
282	FN0209	Hypothetical cytosolic protein	FN0210	Transcriptional regulator, COPG family	->->	836861	837137	277	27.4%	0	0	0	+: 1/1/1 \| -: 0/3/0	1	0	0	0	Result
283	FN0215	MGTC/SAPB Family membrane protein	FN0216	3-oxoacyl-[acyl-carrier protein] reductase	<-<-	840065	840201	137	20.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
285	FN0220	Autolysin sensor kinase	FN0221	Carbon starvation protein A	<-->	845025	845348	324	22.8%	0	0	0	+: 3/3/9 \| -: 1/0/0	1	0	0	0	Result
286	FN0221	Carbon starvation protein A	FN0222	Melibiose carrier protein	->->	846774	846951	178	22.5%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
287	FN0222	Melibiose carrier protein	FN0223	COME operon protein 3	->->	848299	848579	281	20.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
290	FN0234	hypothetical protein	FN0235	ABC transporter ATP-binding protein	<-<-	859590	859763	174	25.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
291	FN0237	ABC transporter permease protein	FN0238	hypothetical protein	<-<-	862219	862471	253	26.5%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
292	FN0238	hypothetical protein	FN0239	hypothetical protein	<-->	863405	863794	390	16.7%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
295	FN0253	Outer membrane protein	FN0254	Fusobacterium outer membrane protein family	->->	875124	876416	1293	32.2%	0	0	2	+: 1/1/1 \| -: 1/1/1	3	0	0	0	Result
296	FN0254	Fusobacterium outer membrane protein family	FN0255	Hypothetical cytosolic protein	->->	881451	882009	559	23.1%	0	0	45	+: 1/1/1 \| -: 2/4/0	1	0	0	0	Result
298	FN0256	Hypothetical cytosolic protein	FN0257	Transporter	->->	882528	882655	128	18%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
303	FN0270	GTP-binding protein era	FN0271	Enoyl-CoA hydratase	->->	897801	897986	186	19.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
307	FN0288	Hypoxanthine-guanine phosphoribosyltransferase	FN0289	hypothetical protein	<-<-	915856	915975	120	20%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
309	FN0293	Hemolysin activator protein precursor	FN0294	Transketolase subunit A	<-->	926650	927288	639	17.7%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
311	FN0299	Aspartyl-tRNA synthetase	FN0300	Iron(III) dicitrate-binding protein	->->	934312	934818	507	24.3%	0	0	0	+: 1/4/2 \| -: 0/1/0	1	0	0	0	Result
313	FN0307	Iron(III) dicitrate transport ATP-binding protein fecE	FN0308	Iron(III)-binding protein	->->	943030	943161	132	20.5%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
314	FN0310	Iron(III)-transport ATP-binding protein sfuC	FN0311	anaerobic ribonucleoside triphosphate reductase	->->	947007	947264	258	14.3%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
315	FN0315	Transcriptional regulator, AraC family	FN0316	hypothetical protein	-><-	952920	953323	404	19.3%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
316	FN0316	hypothetical protein	FN0317	tryptophan synthase subunit beta	<-<-	953780	953908	129	19.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
317	FN0317	tryptophan synthase subunit beta	FN0318	CITX protein	<-<-	955097	955374	278	27.3%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
318	FN0319	Citrate (pro-3S)-lyase ligase	FN0320	Hypothetical cytosolic protein	<-->	956946	957079	134	17.9%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
319	FN0320	Hypothetical cytosolic protein	FN0321	heat shock protein 90	->->	957623	957773	151	19.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
320	FN0321	heat shock protein 90	FN0322	fructose-bisphosphate aldolase	->->	959598	959752	155	17.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
322	FN0327	Bacterial Protein Translation Initiation Factor 3 (IF-3)	FN0328	Na(+)-linked D-alanine glycine permease	<-<-	962240	962424	185	20.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
323	FN0328	Na(+)-linked D-alanine glycine permease	FN0329	50S ribosomal protein L13	<-->	963862	964272	411	25.5%	0	0	0	+: 2/1/1 \| -: 1/1/0	1	0	0	0	Result
324	FN0330	SSU ribosomal protein S9P	FN0331	hypothetical protein	->->	965125	965238	114	18.4%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
325	FN0336	hypothetical protein	FN0337	hypothetical protein	<-<-	970561	971225	665	22.7%	0	0	0	+: 0/2/0 \| -: 2/0/0	1	0	0	0	Result
326	FN0337	hypothetical protein	FN0338	hypothetical protein	<-->	971565	971812	248	20.6%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
327	FN0340	Hypothetical membrane-spanning Protein	FN0341	transport protein	<-<-	974039	974142	104	25%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
331	FN0351	hypothetical protein	FN0352	NA+/H+ antiporter NHAC	->->	983399	983680	282	18.8%	0	0	0	+: 1/2/1 \| -: 0/1/0	1	0	0	0	Result
333	FN0355	S-adenosylmethionine synthetase	FN0356	Lactoylglutathione lyase	<-<-	987318	987570	253	28.9%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
334	FN0358	ATP synthase subunit B	FN0359	ATP synthase gamma chain, sodium ion specific	<-<-	989765	990084	320	26.6%	0	0	1	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
335	FN0364	ATP synthase A chain, sodium ion specific	FN0365	ATP synthase protein I, sodium ion specific	<-<-	994504	994631	128	31.2%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
336	FN0365	ATP synthase protein I, sodium ion specific	FN0366	Phosphoacetylglucosamine mutase	<-<-	994950	995097	148	23%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
340	FN0373	hypothetical protein	FN0374	Single-stranded-DNA-specific exonuclease recJ	->->	1002606	1002793	188	17.6%	0	0	0	+: 1/1/1 \| -: 1/1/0	1	0	0	0	Result
341	FN0374	Single-stranded-DNA-specific exonuclease recJ	FN0375	Iron(III)-binding protein	->->	1005329	1005432	104	20.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
344	FN0386	hypothetical protein	FN0387	Fusobacterium outer membrane protein family	->->	1019950	1021481	1532	30.7%	0	0	2	+: 0/0/0 \| -: 2/4/3	1	0	0	0	Result
346	FN0390	hypothetical protein	FN0391	Hydrolase (HAD superfamily)	<-->	1028559	1028752	194	18.6%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
347	FN0391	Hydrolase (HAD superfamily)	FN0392	Oxygen-independent coproporphyrinogen III oxidase	->->	1029557	1029763	207	29%	0	0	0	+: 0/1/0 \| -: 0/1/0	15	0	0	0	Result
349	FN0400	Dipeptide transport ATP-binding protein dppF	FN0401	hypothetical protein	-><-	1039761	1039994	234	22.2%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
350	FN0401	hypothetical protein	FN0402	Integrase/recombinase	<-->	1040241	1040447	207	20.3%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
356	FN0417	Type III restriction-modification system restriction subunit	FN0418	pyrimidine regulatory protein PyrR	->->	1059021	1059257	237	26.2%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
357	FN0422	carbamoyl-phosphate synthase large subunit	FN0423	Dihydroorotate dehydrogenase electron transfer subunit	->->	1066344	1066467	124	21.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
358	FN0428	hypothetical protein	FN0429	hypothetical protein	->->	1070954	1071088	135	17%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
363	FN0443	hypothetical protein	FN0444	Phosphoadenosine phosphosulfate reductase	->->	1082994	1083213	220	20.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
365	FN0451	hypothetical protein	FN0452	Glucosamine--fructose-6-phosphate aminotransferase [isomerizing]	->->	1095488	1095838	351	27.1%	0	0	0	+: 2/1/2 \| -: 1/0/0	1	0	0	0	Result
366	FN0453	Xaa-Pro aminopeptidase	FN0454	Aldehyde dehydrogenase B	->->	1099442	1099606	165	18.2%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
368	FN0455	Rubrerythrin	FN0456	Hypothetical cytosolic protein	->->	1101874	1102259	386	20.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
369	FN0461	Probable sigma(54) modulation protein	FN0462	DNA mismatch repair protein mutL	->->	1107208	1107323	116	13.8%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
372	FN0472	flavodoxin	FN0473	Regulatory protein betI	<-->	1118256	1118431	176	15.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
373	FN0474	Acriflavin resistance protein B	FN0475	MIAB protein	->->	1122118	1122259	142	16.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
374	FN0476	transcription termination factor Rho	FN0477	Cell wall endopeptidase family M23/M37	->->	1124832	1125011	180	29.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
375	FN0481	hypothetical protein	FN0482	LSU ribosomal protein L31P	->->	1128316	1128434	119	19.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
376	FN0483	Uracil phosphoribosyltransferase	FN0484	Lipase	->->	1129362	1129609	248	25.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	14	0	0	0	Result
379	FN0488	NAD-specific glutamate dehydrogenase	FN0489	Prolipoprotein diacylglyceryl transferase	-><-	1134517	1134648	132	21.2%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
381	FN0493	hypothetical protein	FN0494	Short chain dehydrogenase	<-->	1138643	1138916	274	14.6%	0	0	0	+: 3/0/0 \| -: 1/1/0	1	0	0	0	Result
382	FN0495	Acetyl-CoA acetyltransferase	FN0496	hypothetical protein	->->	1140916	1141049	134	17.2%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
383	FN0498	hypothetical protein	FN0499	Hemin receptor	<-<-	1143380	1146262	2883	27.4%	0	0	1	+: 1/9/2 \| -: 4/2/4	1	0	0	0	Result
384	FN0499	Hemin receptor	FN0500	hypothetical protein	<-->	1148495	1149082	588	19.9%	0	0	2	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
389	FN0512	Flavoprotein	FN0513	Flavodoxin	<-<-	1162688	1162857	170	20.6%	0	0	0	+: 0/2/0 \| -: 1/2/0	1	0	0	0	Result
390	FN0513	Flavodoxin	FN0514	hypothetical protein	<-->	1163287	1163570	284	18%	0	0	0	+: 4/0/0 \| -: 3/1/0	1	0	0	0	Result
391	FN0517	Outer membrane protein tolC	FN0518	Hypothetical exported 24-amino acid repeat protein	<-<-	1169526	1169716	191	17.8%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
392	FN0518	Hypothetical exported 24-amino acid repeat protein	FN0519	Hypothetical exported 24-amino acid repeat protein	<-<-	1170620	1170727	108	19.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
394	FN0527	Alanyl-tRNA synthetase	FN0528	Cold shock protein	<-->	1184189	1184590	402	16.2%	0	0	0	+: 1/1/0 \| -: 1/0/0	1	0	0	0	Result
396	FN0533	Hypothetical membrane-spanning protein	FN0534	hypothetical protein	<-->	1188732	1188997	266	20.3%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
398	FN0540	Glutamate-1-semialdehyde 2,1-aminomutase	FN0541	Hypothetical cytosolic protein	<-->	1194036	1194301	266	15.8%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
400	FN0549	O-sialoglycoprotein endopeptidase	FN0550	Mannose-1-phosphate guanylyl transferase (GDP)	->->	1202492	1202800	309	19.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
401	FN0550	Mannose-1-phosphate guanylyl transferase (GDP)	FN0551	Bacterial regulatory proteins, crp family	->->	1203227	1203415	189	25.9%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
403	FN0556	hypothetical protein	FN0557	hypothetical protein	<-<-	1209091	1209689	599	29.5%	0	0	0	+: 0/1/0 \| -: 3/1/0	1	0	0	0	Result
404	FN0557	hypothetical protein	FN0558	TraT complement resistance protein precursor	<-->	1210425	1210821	397	15.9%	0	0	0	+: 2/0/0 \| -: 2/0/0	1	0	0	0	Result
405	FN0561	Proline synthetase associated protein	FN0562	Hypothetical cytosolic protein	->->	1214967	1215103	137	29.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
411	FN0575	hypothetical protein	FN0576	D-amino acid dehydrogenase large subunit	->->	1225645	1226252	608	24.8%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
412	FN0579	Hypothetical cytosolic protein	FN0580	Penicillin-binding protein	->->	1234779	1235069	291	25.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	3	0	0	0	Result
413	FN0586	Two-component sensor kinase czcS	FN0587	Hypothetical membrane-spanning protein	-><-	1241918	1242052	135	25.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
420	FN0609	SsrA-binding protein	FN0610	hypothetical protein	->->	1264848	1264954	107	15%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
421	FN0612	hypothetical protein	FN0613	hypothetical protein	->->	1270893	1271029	137	20.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
424	FN0632	PTS system, IIA component	FN0633	Replication protein	<-->	1290867	1291067	201	17.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
427	FN0638	hypothetical protein	FN0639	hypothetical protein	<-<-	1297065	1297220	156	23.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
430	FN0651	Ribosomal large subunit pseudouridine synthase D	FN0652	Glyceraldehyde 3-phosphate dehydrogenase	->->	1310321	1310501	181	17.1%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
431	FN0656	hypothetical protein	FN0657	Acetyltransferase	->->	1314246	1314405	160	15.6%	0	0	0	+: 1/2/0 \| -: 0/1/0	1	0	0	0	Result
432	FN0660	ABC transporter ATP-binding protein	FN0661	hypothetical protein	<-->	1317479	1317868	390	22.8%	0	0	0	+: 1/1/0 \| -: 2/2/1	1	0	0	0	Result
433	FN0662	Formiminoglutamase	FN0663	hypothetical protein	->->	1319249	1319425	177	16.4%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
434	FN0664	2-nitropropane dioxygenase	FN0665	N-acetylmuramoyl-L-alanine amidase	->->	1321047	1321224	178	18%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
435	FN0667	Na+ driven multidrug efflux pump	FN0668	High-affinity zinc uptake system protein znuA precursor	<-->	1323715	1324108	394	18.3%	0	0	0	+: 1/3/3 \| -: 3/1/1	1	0	0	0	Result
437	FN0676	10 kDa chaperonin GROES	FN0677	hypothetical protein	<-->	1332471	1332780	310	19.7%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
438	FN0677	hypothetical protein	FN0678	Ser/Thr protein kinase	->->	1333843	1334108	266	14.3%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
440	FN0686	Integral membrane protein	FN0687	hypothetical protein	<-->	1342589	1342702	114	17.5%	0	0	0	+: 1/1/0 \| -: 1/0/0	1	0	0	0	Result
441	FN0687	hypothetical protein	FN0688	hypothetical protein	->->	1344107	1344207	101	15.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
442	FN0688	hypothetical protein	FN0689	hypothetical protein	->->	1344670	1344797	128	20.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
443	FN0690	hypothetical protein	FN0691	hypothetical protein	-><-	1345792	1345916	125	20%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
445	FN0693	DNA mismatch repair protein	FN0694	S-layer protein	->->	1350227	1350992	766	25.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
446	FN0694	S-layer protein	FN0695	ABC transporter ATP-binding protein	->->	1352925	1353025	101	37.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
447	FN0696	hypothetical protein	FN0697	Alanyl-tRNA synthetase	->->	1353987	1354131	145	24.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
449	FN0713	Chromate transport protein	FN0714	NADH oxidase	->->	1372004	1372201	198	24.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	13	0	0	0	Result
451	FN0723	hypothetical protein	FN0724	flavodoxin	-><-	1383525	1383753	229	21.8%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
452	FN0728	hypothetical protein	FN0729	Phosphoglycerate mutase	<-->	1386211	1386493	283	19.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
456	FN0741	Glutamate formiminotransferase	FN0742	hypothetical protein	<-->	1400047	1400260	214	16.4%	0	0	0	+: 2/1/0 \| -: 1/0/0	1	0	0	0	Result
458	FN0748	hypothetical protein	FN0749	hypothetical protein	<-<-	1407634	1407801	168	24.4%	0	0	0	+: 2/0/0 \| -: 2/0/0	1	0	0	0	Result
459	FN0760	hypothetical protein	FN0761	Bvg accessory factor	<-->	1418761	1419008	248	13.7%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
463	FN0774	Hypothetical cytosolic protein	FN0775	putative aminopeptidase 2	->->	1430579	1430707	129	17.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
464	FN0782	Methyltransferase	FN0783	Acyl-CoA dehydrogenase	<-->	1439103	1439305	203	19.7%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
470	FN0799	Isoamylase	FN0800	Amino acid-binding protein	<-<-	1459917	1460036	120	20%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
471	FN0802	Amino acid transport system permease protein	FN0803	trifunctional thioredoxin/methionine sulfoxide reductase A/B protein	<-<-	1462227	1462539	313	18.2%	0	0	0	+: 1/1/1 \| -: 1/2/0	1	0	0	0	Result
473	FN0806	SpoIID homolog	FN0807	3-deoxy-manno-octulosonate cytidylyltransferase	<-<-	1466679	1467246	568	28.7%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
475	FN0812	Hypothetical cytosolic protein	FN0813	Transcriptional regulator, TetR family	-><-	1471458	1471593	136	19.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
477	FN0815	Propionate permease	FN0816	dehydrogenase with MaoC-like domain	->->	1475874	1476110	237	19.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
478	FN0818	DNA-binding protein HU	FN0819	Tetratricopeptide repeat family protein	<-->	1477125	1477387	263	17.5%	0	0	0	+: 1/1/1 \| -: 1/0/0	1	0	0	0	Result
480	FN0820	Mercuric reductase	FN0821	hypothetical protein	->->	1480880	1480998	119	21%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
481	FN0821	hypothetical protein	FN0822	Shikimate kinase	->->	1481866	1481967	102	18.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
483	FN0828	ABC transporter permease protein	FN0829	hypothetical protein	-><-	1489566	1489669	104	29.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
484	FN0829	hypothetical protein	FN0830	hypothetical protein	<-->	1489964	1490393	430	21.4%	0	0	0	+: 2/0/0 \| -: 1/1/1	1	0	0	0	Result
487	FN0834	hypothetical protein	FN0835	hypothetical protein	->->	1498149	1498328	180	23.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
488	FN0837	Integrase/recombinase	FN0838	hypothetical protein	->->	1500252	1500886	635	19.2%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
490	FN0842	hypothetical protein	FN0843	hypothetical protein	<-<-	1503146	1503275	130	24.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
492	FN0844	hypothetical protein	FN0845	hypothetical protein	->->	1503835	1504074	240	20.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
494	FN0860	hypothetical protein	FN0861	hypothetical protein	<-<-	1521654	1521827	174	25.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
499	FN0871	3-dehydroquinate synthase	FN0872	hypothetical protein	<-<-	1531858	1531963	106	18.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
500	FN0873	Protease IV	FN0874	Phosphohydrolase (MUTT/NUDIX family protein)	<-<-	1534278	1534461	184	22.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
501	FN0875	23S rRNA methyltransferase	FN0876	Gamma-glutamyltranspeptidase	<-<-	1535765	1535883	119	16.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
502	FN0877	Sodium/proline symporter	FN0878	Transcriptional regulator, GntR family	<-<-	1538964	1539176	213	16.9%	0	0	0	+: 1/2/1 \| -: 1/1/0	1	0	0	0	Result
503	FN0878	Transcriptional regulator, GntR family	FN0879	ABC transporter integral membrane protein	<-<-	1539885	1540250	366	21.3%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
504	FN0881	ABC transporter integral membrane protein	FN0882	Hemin transport system ATP-binding protein hmuV	<-<-	1542838	1543036	199	13.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
507	FN0886	Hemin receptor	FN0887	Oligoendopeptidase F	-><-	1547891	1547998	108	17.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
509	FN0896	hypothetical protein	FN0897	Hypothetical cytosolic protein	<-->	1555871	1555972	102	17.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
512	FN0921	hypothetical protein	FN0922	Homoserine kinase	<-<-	1576573	1576677	105	20%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
513	FN0923	Cardiolipin synthetase	FN0924	hypothetical protein	<-->	1579068	1579392	325	21.2%	0	0	0	+: 2/0/0 \| -: 0/2/0	1	0	0	0	Result
516	FN0938	hypothetical protein	FN0939	Hypothetical membrane-spanning protein	<-<-	1591216	1591737	522	28.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
520	FN0949	DNA helicase	FN0950	Precorrin-6X reductase	<-<-	1606850	1607064	215	26.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
521	FN0953	hypothetical protein	FN0954	Hypothetical cytosolic protein	<-<-	1610337	1610458	122	17.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
522	FN0954	Hypothetical cytosolic protein	FN0955	hypothetical protein	<-<-	1611707	1612017	311	15.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
523	FN0962	Hypothetical cytosolic protein	FN0963	hypothetical protein	<-<-	1616978	1617219	242	21.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
527	FN0990	Phosphoribosylformylglycinamidine synthase	FN0991	CDP-diacylglycerol--serine O-phosphatidyltransferase	<-->	1645519	1645949	431	21.6%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
528	FN0997	hypothetical protein	FN0998	Dipeptide-binding protein	<-->	1652125	1652386	262	16%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
529	FN0999	Deblocking aminopeptidase	FN1000	biotin synthase	->->	1654938	1655078	141	21.3%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
530	FN1002	Adenosylmethionine-8-amino-7-oxononanoate aminotransferase	FN1003	Outer membrane protein P1 precursor	->->	1658237	1658961	725	31.4%	0	0	1	+: 1/2/0 \| -: 1/1/1	1	0	0	0	Result
534	FN1009	hypothetical protein	FN1010	Hypothetical cytosolic protein	<-<-	1664041	1664401	361	24.7%	0	0	1	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
536	FN1018	hypothetical protein	FN1019	3-hydroxybutyryl-CoA dehydrogenase	<-<-	1672460	1673034	575	21.6%	0	0	2	+: 0/0/0 \| -: 1/3/2	1	0	0	0	Result
538	FN1024	DNA-binding protein HU	FN1025	Guanine-hypoxanthine permease	<-<-	1678571	1678713	143	18.2%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
541	FN1045	hypothetical protein	FN1046	hypothetical protein	<-->	1696078	1696510	433	24.9%	0	0	0	+: 2/1/2 \| -: 1/1/0	1	0	0	0	Result
543	FN1055	Cysteine synthase	FN1056	hypothetical protein	<-->	1703591	1703832	242	16.9%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
546	FN1069	DNA topoisomerase I	FN1070	glucose-inhibited division protein A	->->	1717143	1717260	118	20.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
548	FN1076	hypothetical protein	FN1077	hypothetical protein	-><-	1723738	1723843	106	21.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
550	FN1078	Hypothetical exported 24-amino acid repeat protein	FN1079	Neutrophil-activating protein A	->->	1724839	1725102	264	14%	0	0	0	+: 1/2/0 \| -: 0/2/0	1	0	0	0	Result
553	FN1083	putative surface protein	FN1084	hypothetical protein	->->	1728700	1728800	101	20.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
555	FN1087	hypothetical protein	FN1088	NADH oxidase	->->	1731677	1731847	171	22.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
557	FN1094	Dolichol-phosphate mannosyltransferase	FN1095	hypothetical protein	<-->	1739880	1740371	492	15.2%	0	0	0	+: 2/1/1 \| -: 0/1/0	1	0	0	0	Result
558	FN1098	hypothetical protein	FN1099	hypothetical protein	->->	1743959	1744104	146	21.9%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
560	FN1106	L-serine dehydratase	FN1107	Acetyltransferase	->->	1751934	1752100	167	23.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
561	FN1108	Phosphohydrolase (MUTT/NUDIX family protein)	FN1109	Dipeptide transport ATP-binding protein dppF	-><-	1752939	1753083	145	18.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
563	FN1114	hypothetical protein	FN1115	Hypothetical membrane-spanning protein	->->	1758747	1758924	178	20.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
564	FN1116	Peptidase E	FN1117	LSU ribosomal protein L21P	->->	1760273	1760381	109	27.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
565	FN1119	50S ribosomal protein L27	FN1120	phosphoenolpyruvate carboxykinase	->->	1761314	1761577	264	14.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
566	FN1121	ATP-dependent Zn protease	FN1122	Long-chain-fatty-acid--CoA ligase	<-<-	1764731	1764896	166	18.1%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
567	FN1122	Long-chain-fatty-acid--CoA ligase	FN1123	Thioredoxin-like protein	<-->	1767384	1767617	234	17.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
568	FN1124	Outer membrane porin F	FN1125	LemA protein	<-<-	1769096	1769349	254	28.7%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
572	FN1137	Phosphonates transport system permease protein phnE	FN1138	Hypothetical cytosolic protein	->->	1785478	1785608	131	13.7%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
573	FN1138	Hypothetical cytosolic protein	FN1139	Activator of (R)-2-hydroxyglutaryl-CoA dehydratase	->->	1786041	1786380	340	19.4%	0	0	0	+: 1/1/1 \| -: 1/2/0	1	0	0	0	Result
574	FN1141	Formate transporter	FN1142	Oxygen-independent coproporphyrinogen III oxidase	<-->	1791354	1791668	315	21.9%	0	0	0	+: 1/2/0 \| -: 2/0/0	1	0	0	0	Result
575	FN1145	Oligoendopeptidase F	FN1146	Hypothetical exported 24-amino acid repeat protein	<-<-	1796022	1796169	148	19.6%	0	0	0	+: 0/0/0 \| -: 1/1/1	1	0	0	0	Result
576	FN1146	Hypothetical exported 24-amino acid repeat protein	FN1147	hypothetical protein	<-<-	1796557	1796683	127	25.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
577	FN1147	hypothetical protein	FN1148	Serine/threonine sodium symporter	<-->	1797920	1798151	232	20.3%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
579	FN1161	Glutamate racemase	FN1162	Hydroxyacylglutathione hydrolase	->->	1820114	1820300	187	18.2%	0	0	0	+: 1/1/1 \| -: 0/2/0	1	0	0	0	Result
581	FN1169	L-lactate dehydrogenase	FN1170	Pyruvate-flavodoxin oxidoreductase	<-<-	1828627	1828796	170	18.2%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
582	FN1172	Phosphate acetyltransferase	FN1173	hypothetical protein	<-->	1834716	1835400	685	18.8%	0	0	0	+: 0/0/0 \| -: 3/0/0	1	0	0	0	Result
583	FN1174	hypothetical protein	FN1175	hypothetical protein	-><-	1835793	1836646	854	22%	0	0	0	+: 0/4/0 \| -: 2/5/4	2	0	0	0	Result
584	FN1175	hypothetical protein	FN1176	Hypothetical cytosolic protein	<-<-	1836839	1837595	757	18.5%	0	0	0	+: 0/2/0 \| -: 3/0/0	2	0	0	0	Result
586	FN1184	hypothetical protein	FN1185	SIR2 family protein	<-<-	1847198	1847652	455	20.2%	0	0	0	+: 1/1/0 \| -: 3/0/0	1	0	0	0	Result
587	FN1185	SIR2 family protein	FN1186	Amidohydrolase	<-->	1848412	1848895	484	17.6%	0	0	0	+: 1/1/0 \| -: 1/0/0	1	0	0	0	Result
590	FN1195	hypothetical protein	FN1196	hypothetical protein	<-<-	1856330	1856601	272	16.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
591	FN1198	Transporter	FN1199	DNA polymerase IV	<-->	1859032	1859200	169	17.8%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
597	FN1221	hypothetical protein	FN1222	hypothetical protein	-><-	1881351	1881669	319	26.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
598	FN1227	hypothetical protein	FN1228	hypothetical protein	<-<-	1885798	1885971	174	25.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
599	FN1230	Hypothetical cytosolic protein	FN1231	Inosine-5'-monophosphate dehydrogenase	<-<-	1887263	1887532	270	27.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
600	FN1233	Putative NAD(P)H oxidoreductase	FN1234	hypothetical protein	->->	1890072	1890279	208	16.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
602	FN1235	Ankyrin repeat proteins	FN1236	Choline transport protein	-><-	1892489	1892601	113	20.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
605	FN1247	LOS biosynthesis enzyme LBGB	FN1248	Hypothetical cytosolic protein	<-<-	1904435	1904689	255	28.2%	0	0	0	+: 0/0/0 \| -: 1/2/1	1	0	0	0	Result
606	FN1249	Transcriptional regulator, DeoR family	FN1250	Guanine-hypoxanthine permease	<-<-	1906332	1906575	244	19.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
607	FN1250	Guanine-hypoxanthine permease	FN1251	High-affinity iron permease	<-->	1907923	1908147	225	17.8%	0	0	0	+: 2/0/0 \| -: 1/1/0	1	0	0	0	Result
609	FN1257	C4-dicarboxylate transporter small subunit	FN1258	C4-dicarboxylate-binding protein	<-<-	1913755	1913881	127	22%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
610	FN1258	C4-dicarboxylate-binding protein	FN1259	Uracil-DNA glycosylase	<-->	1914884	1915222	339	17.4%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
611	FN1259	Uracil-DNA glycosylase	FN1260	Sensory Transduction Protein Kinase	-><-	1915817	1915952	136	27.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
613	FN1263	Cobalt chelatase	FN1264	hypothetical protein	<-->	1920667	1920905	239	22.2%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
614	FN1264	hypothetical protein	FN1265	Outer membrane protein	->->	1921269	1921470	202	17.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
615	FN1265	Outer membrane protein	FN1266	UTP--glucose-1-phosphate uridylyltransferase	-><-	1922080	1922247	168	19.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
616	FN1270	Hypothetical cytosolic protein	FN1271	Protease IV	<-<-	1926683	1926834	152	27.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
617	FN1271	Protease IV	FN1272	Transcriptional regulator, TetR family	<-->	1928533	1928777	245	20%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
618	FN1278	Acetyltransferase	FN1279	Zinc metallohydrolase, glyoxalase II family	<-<-	1937265	1937379	115	27.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
619	FN1279	Zinc metallohydrolase, glyoxalase II family	FN1280	Endonuclease	<-->	1938361	1938581	221	17.6%	0	0	0	+: 1/0/0 \| -: 3/0/0	1	0	0	0	Result
620	FN1286	30S ribosomal protein S13	FN1287	Bacterial Protein Translation Initiation Factor 1 (IF-1)	<-<-	1944165	1944504	340	27.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	1	220	322	Result	ttgtttatgtttaggattttcacagattactcttatttttccatgtcttttaataatcttacacttgtcacaaataggttttattgatactcttactttcatt
626	FN1304	Single-strand DNA binding protein	FN1305	Hypothetical cytosolic protein	<-->	1960854	1961344	491	20.4%	0	0	1	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
628	FN1307	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	FN1308	Phosphatidate cytidylyltransferase	->->	1964117	1964279	163	20.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
630	FN1314	hypothetical protein	FN1315	hypothetical protein	<-<-	1968773	1969010	238	40.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
631	FN1318	RNA polymerase sigma factor rpoD	FN1319	DNA primase	<-<-	1972187	1972475	289	29.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
632	FN1320	Peptidyl-prolyl cis-trans isomerase	FN1321	Acetoacetate metabolism regulatory protein atoC	<-<-	1975422	1976070	649	27%	0	0	3	+: 0/3/0 \| -: 0/0/0	1	0	0	0	Result
634	FN1328	Exodeoxyribonuclease VII small subunit	FN1329	Methyltransferase	<-<-	1983220	1983431	212	22.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
635	FN1334	N-acetylmuramoyl-L-alanine amidase	FN1335	Protein translocase subunit YajC	<-<-	1988710	1988816	107	21.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
636	FN1335	Protein translocase subunit YajC	FN1336	hypothetical protein	<-<-	1989102	1990025	924	20.9%	0	0	0	+: 3/3/6 \| -: 2/3/6	1	0	0	0	Result
638	FN1341	Bacterial Peptide Chain Release Factor 2 (RF-2)	FN1342	Holo-[acyl-carrier protein] synthase	<-<-	1995987	1996180	194	25.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
641	FN1347	Hypothetical cytosolic protein	FN1348	ABC transporter ATP-binding protein	<-<-	2000391	2000559	169	22.5%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
642	FN1350	Integral membrane protein	FN1351	15 kDa lipoprotein precursor	<-<-	2002887	2003039	153	22.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
643	FN1351	15 kDa lipoprotein precursor	FN1352	ABC transporter ATP-binding protein	<-<-	2003463	2003595	133	36.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
644	FN1355	Integral membrane protein	FN1356	hypothetical protein	<-->	2007666	2008061	396	26.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
648	FN1374	Transcriptional regulator	FN1375	Citrate-sodium symport	<-->	2022392	2022555	164	17.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
649	FN1381	hypothetical protein	FN1382	ATPase	<-->	2032525	2033288	764	22.8%	0	0	0	+: 2/3/0 \| -: 1/3/3	1	0	0	0	Result
650	FN1384	IAA acetyltransferase	FN1385	hypothetical protein	<-<-	2038347	2038483	137	27%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
653	FN1395	hypothetical protein	FN1396	hypothetical protein	<-->	2051621	2051791	171	17.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
654	FN1398	Amino acid carrier protein alsT	FN1399	Hypothetical cytosolic protein	->->	2054361	2054494	134	19.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
655	FN1400	serine/threonine kinase	FN1401	urocanate hydratase	->->	2058536	2058731	196	15.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
656	FN1402	Hypothetical membrane-spanning protein	FN1403	Histidine permease	->->	2061761	2061882	122	26.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
657	FN1408	Aminoacyl-histidine dipeptidase	FN1409	Transporter	->->	2069005	2069148	144	16%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
658	FN1409	Transporter	FN1410	Transporter	->->	2069893	2070073	181	29.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
659	FN1410	Transporter	FN1411	Threonine dehydratase	->->	2070566	2070869	304	18.8%	0	0	0	+: 2/4/4 \| -: 0/2/0	1	0	0	0	Result
662	FN1419	methionine gamma-lyase	FN1420	NA+/H+ antiporter NHAC	->->	2081893	2082038	146	25.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
664	FN1425	hypothetical protein	FN1426	Serine protease	-><-	2092291	2092666	376	16.2%	0	0	0	+: 0/2/0 \| -: 1/2/0	1	0	0	0	Result
665	FN1426	Serine protease	FN1427	Phenazine biosynthesis protein phzF	<-->	2095553	2095941	389	29.8%	0	0	0	+: 1/0/0 \| -: 1/2/0	1	0	0	0	Result
667	FN1430	Branched-chain amino acid transport system permease protein livM	FN1431	Branched-chain amino acid transport system permease protein livH	<-<-	2099293	2099415	123	21.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
668	FN1431	Branched-chain amino acid transport system permease protein livH	FN1432	Leucine-, isoleucine-, valine-, threonine-, and alanine-binding protein	<-<-	2100343	2100518	176	20.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
669	FN1432	Leucine-, isoleucine-, valine-, threonine-, and alanine-binding protein	FN1433	Short chain dehydrogenase	<-<-	2101671	2101827	157	19.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
671	FN1437	LSU ribosomal protein L28P	FN1438	hypothetical protein	<-->	2106238	2106463	226	19.5%	0	0	0	+: 1/1/0 \| -: 1/1/1	1	0	0	0	Result
674	FN1444	GMP synthase [glutamine-hydrolyzing]	FN1445	DNA helicase	->->	2113264	2113463	200	26%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
677	FN1448	Hypothetical cytosolic protein	FN1449	Fusobacterium outer membrane protein family	<-<-	2118519	2118701	183	22.4%	0	0	0	+: 0/0/0 \| -: 2/1/0	1	0	0	0	Result
680	FN1453	hypothetical protein	FN1454	D-alanine--D-alanine ligase	<-<-	2134739	2134885	147	23.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
681	FN1459	Phospho-N-acetylmuramoyl-pentapeptide- transferase	FN1460	Hypothetical cytosolic protein	<-->	2141451	2141568	118	22.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
682	FN1462	Transcriptional regulator, GntR family	FN1463	pyridoxine biosynthesis protein	<-->	2145036	2145141	106	20.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
683	FN1464	1-deoxy-D-xylulose-5-phosphate synthase	FN1465	Permease	<-->	2147796	2148125	330	22.7%	0	0	1	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
684	FN1469	Na+ driven multidrug efflux pump	FN1470	hypothetical protein	<-->	2151800	2152007	208	19.7%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
685	FN1476	N-acetylmannosamine-6-phosphate 2-epimerase	FN1477	Hypothetical membrane-spanning protein	->->	2159487	2159643	157	24.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
Total:										0	5	0/79		391	3