CDS GC%: 43.5% tRNA GC%: 56.8% rRNA GC%: 52%

IGS#	Up stream Locus	Up stream Product	Down Stream Locus	Down Stream Product	Gene Dir type	Start	End	IGS Len	GC%	IS NT	IS AA	NR	PT-Pair	Intra Spp. IGS	Inter Spp. IGS	Conserved Inter-spp IGS Start	Conserved Inter-spp IGS End	Blast Result	Conserved IGS Seq
1	SSA_2382	Chromosome partitioning protein ParB or transcriptional regulator Spo0J, putative	SSA_0001	Chromosomal replication initiator protein dnaA, putative	->->	1	213	213	25.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
2	SSA_0001	Chromosomal replication initiator protein dnaA, putative	SSA_0002	DNA polymerase III, beta chain, putative	->->	1567	1724	158	26.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
3	SSA_0002	DNA polymerase III, beta chain, putative	SSA_2390	hypothetical protein	->->	2862	2988	127	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
4	SSA_2390	hypothetical protein	SSA_0004	Lipoprotein, putative	-><-	3184	3302	119	30.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
5	SSA_0004	Lipoprotein, putative	SSA_0005	GTP-binding protein, putative	<-->	3795	3960	166	25.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
12	SSA_0020	Ribose-phosphate pyrophosphokinase 1, putative	SSA_0021	hypothetical protein	->->	26670	26981	312	28.5%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
13	SSA_0022	Surface protein cell wall anchor, sortase_B family, putative	SSA_0023	Aspartate aminotransferase, putative	->->	28489	28668	180	38.9%	0	0	0	+: 1/1/1 \| -: 0/2/0	1	0	0	0	Result
14	SSA_0027	Acyl carrier protein, putative	SSA_0028	Phosphoribosylaminoimidazole-succinocarboxamide synthase, putative	->->	31863	32022	160	29.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
15	SSA_0035	Bifunctional purine biosynthesis protein purH, putative	SSA_0036	Secreted protein, possible function in cell-wall metabolism (amidase), putative	-><-	42018	42139	122	37.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
16	SSA_0036	Secreted protein, possible function in cell-wall metabolism (amidase), putative	SSA_0037	Phosphoribosylamine-glycine ligase; phosphoribosyl glycinamide synthetase (GARS), putative	<-->	44090	44411	322	32.9%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
17	SSA_0037	Phosphoribosylamine-glycine ligase; phosphoribosyl glycinamide synthetase (GARS), putative	SSA_0039	Phosphoribosylaminoimidazole carboxylase, catalytic subunit, putative	->->	45675	45972	298	38.6%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	6	130	287	Result	cgtagtcgccaaacaagataatgatcaccgtggtgaaaagaccagaacagtgtatgttctggtctagggaaaatttgagactttaggctcaaattttaggaatgaaaccgaaggtttgcttccgacccaccacttaaaaccattatcaaaaagaaaaa
19	SSA_0042	Amino acid recemase, putative	SSA_0043	hypothetical protein	->->	48732	48940	209	45.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
20	SSA_0044	hypothetical protein	SSA_0045	hypothetical protein	->->	50318	50472	155	27.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
21	SSA_0048	Transcriptional regulator, TetR/AcrR family, putative	SSA_0049	Dihydroxyacetone kinase (Dak1), putative	<-->	53534	53751	218	33.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
22	SSA_0051	Dihydroxyacetone kinase phosphotransfer protein, putative	SSA_0052	Transcriptional regulator, GntR family, putative	-><-	55705	56031	327	28.4%	0	0	0	+: 1/1/1 \| -: 0/2/0	1	0	0	0	Result
23	SSA_0052	Transcriptional regulator, GntR family, putative	SSA_0053	Beta-galactosidase, putative	<-->	56749	56887	139	23.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
24	SSA_0057	Phosphotransferase system sugar-specific EII component, putative	SSA_0060	Tagatose-6-phosphate ketose/aldose isomerase, putative	->->	61307	61616	310	46.5%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
25	SSA_0062	Aldose 1-epimerase, putative	SSA_0063	Holliday junction DNA helicase ruvB, putative	->->	64919	65474	556	34.4%	0	0	0	+: 2/2/1 \| -: 2/6/2	2	0	0	0	Result
26	SSA_0064	hypothetical protein	SSA_0065	Low molecular weight phosphotyrosine protein phosphatase, putative	->->	67040	67314	275	31.3%	0	0	0	+: 0/4/0 \| -: 1/2/2	1	0	0	0	Result
27	SSA_0067	Acyltransferase (yrhL-like subfamily of SGNH-hydrolases), putative	SSA_0068	Alcohol-acetaldehyde dehydrogenase, putative	->->	69951	70253	303	26.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
28	SSA_0068	Alcohol-acetaldehyde dehydrogenase, putative	SSA_0069	Hypothetical protein, possibly membrane-associated	->->	72909	73176	268	45.9%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
29	SSA_0069	Hypothetical protein, possibly membrane-associated	SSA_0070	Acetylxylan esterase, putative	->->	73858	73972	115	36.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
30	SSA_0070	Acetylxylan esterase, putative	SSA_0071	N-acetylmannosamine-6-p hosphate 2-epimerase 1, putative	->->	74975	75349	375	35.5%	0	0	0	+: 1/3/3 \| -: 1/3/0	1	0	0	0	Result
31	SSA_0081	Transcriptional regulator, RpiR family (phosphosugar-binding), putative	SSA_0083	hypothetical protein	<-->	85162	85576	415	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
32	SSA_0085	V-type sodium ATPase, subunit I, putative	SSA_0086	V-type sodium ATPase, subunit K, putative	->->	87846	87978	133	30.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
33	SSA_0093	V-type sodium ATPase, subunit D, putative	SSA_0094	Cell wall metabolism, LysM type protein, putative	->->	95050	95484	435	36.8%	0	0	0	+: 0/3/0 \| -: 1/4/0	1	0	0	0	Result
34	SSA_0094	Cell wall metabolism, LysM type protein, putative	SSA_0095	Threonine synthase, putative	->->	96583	96694	112	33%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
35	SSA_0095	Threonine synthase, putative	SSA_0097	Multi antimicrobial extrusion (MATE) family transporter, putative	->->	98180	98287	108	35.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
36	SSA_0099	hypothetical protein	SSA_0100	DNA polymerase I - 3'-5' exonuclease and polymerase domains, putative	<-->	100710	100819	110	31.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
37	SSA_0100	DNA polymerase I - 3'-5' exonuclease and polymerase domains, putative	SSA_0101	Conserved uncharacterized protein	->->	103463	103735	273	37.7%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
38	SSA_0103	Integral membrane protein, putative	SSA_0104	Queuine tRNA-ribosyltransferase, putative	<-->	105581	105732	152	38.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
39	SSA_0105	Uridine kinase, putative	SSA_0106	30S ribosomal protein S10, putative	->->	107540	107911	372	34.1%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	19	198	372	Result	caaatcccttgcaatgactggttctttgtgttaagatactatggtgctgtaaaaatacagcgtgtagctttgatgcaagaggttgcgacacgctcggttgcattgccacgcaatcacctgtcggttttcttgtggagctagcctattatcttaaatagacgaaaaggagaaaaag
40	SSA_2391	30S ribosomal protein S14, putative	SSA_0120	30S ribosomal protein S8, putative	->->	114578	114757	180	39.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
41	SSA_0120	30S ribosomal protein S8, putative	SSA_0121	hypothetical protein	->->	115157	115322	166	34.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	11	5	114	Result	aagatacaaagagcgtcatgggcaatgtgaaaataggaaatctgacaaagagtgttaacactctaggaagatttgtctttttcacacagaccatagctcgtgttcaattt
42	SSA_0125	50S ribosomal protein L30, putative	SSA_0126	50S ribosomal protein L15, putative	->->	117253	117406	154	33.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
43	SSA_0127	Multispanning membrane protein, translocator of proteins, putative	SSA_0128	Adenylate kinase, putative	->->	119168	119340	173	32.9%	0	0	0	+: 0/2/0 \| -: 0/3/0	1	0	0	0	Result
44	SSA_0128	Adenylate kinase, putative	SSA_0129	Translation initiation factor IF-1, putative	->->	119980	120096	117	35.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
49	SSA_0138	Metal-binding (Zn) permease, putative	SSA_0139	Copper transport operon or penicillinase transcriptional repressor, putative	->->	134176	134322	147	27.9%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
50	SSA_0141	Copper chaperone, putative	SSA_0142	hypothetical protein	->->	137252	137369	118	37.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
51	SSA_0143	Conserved uncharacterized protein	SSA_0144	Transcriptional regulator, TetR family, putative	-><-	137941	138082	142	35.2%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
52	SSA_0144	Transcriptional regulator, TetR family, putative	SSA_0145	Transcriptional regulator, TetR family, putative	<-<-	138656	138867	212	29.2%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
53	SSA_0145	Transcriptional regulator, TetR family, putative	SSA_0146	DNA repair ATPase, putative	<-->	139471	139825	355	27.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
55	SSA_0148	Sugar ABC transporter, ATP-binding protein, putative	SSA_0149	hypothetical protein	->->	143528	143713	186	35.5%	0	0	0	+: 1/0/0 \| -: 0/2/0	1	0	0	0	Result
56	SSA_0149	hypothetical protein	SSA_0150	hypothetical protein	->->	143894	144075	182	30.8%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
57	SSA_0150	hypothetical protein	SSA_0151	hypothetical protein	->->	145288	145493	206	37.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
58	SSA_0153	hypothetical protein	SSA_0154	hypothetical protein	->->	149564	149975	412	35%	0	0	0	+: 0/4/0 \| -: 0/0/0	1	0	0	0	Result
59	SSA_0156	ATPase with chaperone activity, ATP-binding subunit, putative	SSA_0157	hypothetical protein	->->	153383	153652	270	33.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
60	SSA_0159	hypothetical protein	SSA_0160	hypothetical protein	->->	157117	158874	1758	36.7%	0	0	0	+: 3/5/8 \| -: 3/4/2	2	0	0	0	Result
61	SSA_0166	hypothetical protein	SSA_0167	Hypothetical protein (Asparagine/proline-rich)	->->	165207	165393	187	33.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
62	SSA_0167	Hypothetical protein (Asparagine/proline-rich)	SSA_0168	hypothetical protein	->->	166396	166596	201	27.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
63	SSA_0168	hypothetical protein	SSA_0169	hypothetical protein	->->	167578	167880	303	34%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
64	SSA_0169	hypothetical protein	SSA_0170	hypothetical protein	-><-	168076	168219	144	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
65	SSA_0171	Cro-like transcriptional repressor, XRE family, putative	SSA_0172	Transcriptional regulator, XRE family, putative	<-->	169047	169279	233	24.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
66	SSA_0174	Tyrosyl-tRNA synthetase 1, putative	SSA_0134	Membrane carboxypeptidase (penicillin-binding protein), putative	<-->	171979	172129	151	27.8%	0	0	0	+: 1/0/0 \| -: 0/2/0	1	0	0	0	Result
67	SSA_0175	Penicillin-binding protein 1B, putative	SSA_0176	DNA-directed RNA polymerase I, beta chain (140 kDa subunit), putative	->->	174545	175120	576	34.4%	0	0	50	+: 1/4/0 \| -: 0/1/0	1	1	84	195	Result	atttgtcgtgtgctttatttgaaatattgtccaaatagaagcttacagcagttaaatcaaacttgaataagtcagatttagctgctctttttgtgcctatttttaggaaaaa
68	SSA_0177	DNA-directed RNA polymerase I, beta chain (160 kDa subunit), putative	SSA_0178	UDP-N-acetylglucosamine 2-epimerase, putative	->->	182193	182955	763	27.8%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
69	SSA_0182	Endoglucanase, putative	SSA_0183	hypothetical protein	->->	187468	187785	318	32.4%	0	0	0	+: 1/3/0 \| -: 1/4/0	1	0	0	0	Result
71	SSA_0192	Acetate kinase, putative	SSA_0193	CAAX amino terminal protease family protein, putative	->->	194243	194457	215	33%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
72	SSA_0193	CAAX amino terminal protease family protein, putative	SSA_0195	hypothetical protein	->->	195136	195252	117	35%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
73	SSA_0195	hypothetical protein	SSA_0197	Dihydropteroate synthase, putative	->->	195892	196085	194	39.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
74	SSA_0205	NisK (sensor-receptor histidine kinase domain), putative	SSA_2393	Transcriptional regulator, XRE family, putative	->->	203900	204195	296	41.2%	0	0	0	+: 1/1/0 \| -: 0/2/0	2	1	30	142	Result	gagtgggacagaaatcggtaattcgttagaattcgatttcgtcgtcccacctccgcacagttgagtagggctgtaaaagctgatgaaatcagcgtagtagagcccactcaacc
75	SSA_0208	Conserved uncharacterized protein	SSA_0209	Glutamyl aminopeptidase, putative	<-<-	206543	206661	119	35.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
76	SSA_0209	Glutamyl aminopeptidase, putative	SSA_0210	hypothetical protein	<-->	207727	207896	170	39.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
77	SSA_0212	Phenylalanyl-tRNA synthetase, beta subunit, putative	SSA_0213	hypothetical protein	-><-	209140	209637	498	28.9%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
78	SSA_0213	hypothetical protein	SSA_0214	Single-strand DNA-binding protein (conjugal DNA-protein transfer system), putative	<-->	210226	210354	129	34.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
79	SSA_0214	Single-strand DNA-binding protein (conjugal DNA-protein transfer system), putative	SSA_0215	Periplasmic sugar-binding protein (ribose porter), putative	->->	210751	211030	280	34.3%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
80	SSA_0218	Sugar-binding periplasmic protein, putative	SSA_0219	PTS system, sugar-specific enzyme IIA component, putative	->->	215287	215506	220	34.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
81	SSA_0224	hypothetical protein	SSA_0225	10 kDa chaperonin	->->	218579	218781	203	32.5%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
82	SSA_0226	60 kDa chaperonin	SSA_0227	Collagen-binding surface protein, putative	->->	220710	221176	467	25.7%	0	0	0	+: 1/2/2 \| -: 0/0/0	1	0	0	0	Result
83	SSA_0227	Collagen-binding surface protein, putative	SSA_0228	hypothetical protein	->->	223031	223502	472	34.5%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
84	SSA_0229	hypothetical protein	SSA_0230	hypothetical protein	-><-	223774	223901	128	37.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
85	SSA_0230	hypothetical protein	SSA_0231	Conserved uncharacterized protein	<-->	225048	225852	805	31.1%	0	0	0	+: 1/5/4 \| -: 1/6/6	1	2	188	805	Result	tacacaaaaaagcctagtaaatcaaggctttttcctgttgtatttagatgccccctacagggatttggaaaggactttcatattgagagcaattaaaaatattgaaatataagtgattttaggtattttcaatgtcatgatttaaaaatgggacaaaagtggggcaaaaaccatacagattctaaactgtatggttctttttttatctaaccaagaaaggttaaaacttattaaaacaaatgcaatcaactgttgaaaactttttagtccgtgtaatataaaaacaagtaaaaagttgaactatagggaatattgtgtcataataggtaatagatgaataattaatagattggaaataatgctttcttaccttaacaagttgaattggttatacattttttcgtcgcaattgtgtctatctctcgagtttagctagtttttataagctctggtttctaatcaatataacaaattttagaagtgcataagacaagatggtgacattactacagtcatttctagtcaccatatgttgctggcacaggctgtttgtagtgttggctatttactagtcagtttaatcggagtgtttaatttttattgttgaaaggtttttat
87	SSA_0234	hypothetical protein	SSA_0235	Integrase/recombinase, phage associated, putative	<-->	229029	229700	672	31.4%	0	0	9	+: 2/3/6 \| -: 1/2/2	1	0	0	0	Result
89	SSA_0240	Acetyltransferase, GNAT family, putative	SSA_0241	Ribosomal protein L11 methyltransferase, putative	->->	234021	234160	140	36.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	4	7	137	Result	aaaggattgttcagttaaatttctaaactgaacccgccctaaacactgtggcaaaaagataaaattctcttagacgcaaacgtcgtcagagaatttcctgttttggatttgtgttttacgggcttggtatt
90	SSA_0243	Cyclo-nucleotide phosphodiesterase, putative	SSA_0244	hypothetical protein	<-->	238326	238837	512	35.5%	0	0	0	+: 1/2/0 \| -: 1/1/1	1	0	0	0	Result
91	SSA_0245	hypothetical protein	SSA_0246	Conserved uncharacterized protein	->->	239669	239842	174	27.6%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
92	SSA_0249	hypothetical protein	SSA_0250	GTP pyrophosphokinase, putative	->->	242176	242306	131	44.3%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
93	SSA_0252	hypothetical protein	SSA_0253	CAAX amino terminal protease family protein, putative	<-->	245930	246428	499	30.9%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
94	SSA_0253	CAAX amino terminal protease family protein, putative	SSA_0254	hypothetical protein	-><-	247044	247156	113	34.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
95	SSA_0255	Multiple antibiotic resistance operon transcription repressor (MarR), putative	SSA_0256	Metalloregulator ScaR (Fe/Mn-dependent transcriptional repressor), putative	<-<-	248037	248141	105	31.4%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
96	SSA_0256	Metalloregulator ScaR (Fe/Mn-dependent transcriptional repressor), putative	SSA_0257	N-acetylmuramidase/lysin, putative	<-->	248790	249017	228	29.8%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
98	SSA_0262	ABC-type Mn/Zn transporter, ATP-ase component, putative	SSA_0263	Zinc metalloproteinase in scaA 5'region, putative	<-->	256295	256413	119	19.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
99	SSA_0263	Zinc metalloproteinase in scaA 5'region, putative	SSA_0264	PEP phosphonomutase-like protein, putative	->->	258307	258539	233	28.8%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
101	SSA_0267	ROK family protein, putative	SSA_0268	Phosphotransferase system (PTS) cellobiose-specific component IIB, putative	<-->	262160	262363	204	29.4%	0	0	0	+: 1/1/0 \| -: 1/0/0	1	0	0	0	Result
102	SSA_0272	Oxidoreductase, aldo/keto reductase family, putative	SSA_0273	hypothetical protein	->->	267093	267210	118	36.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
103	SSA_0274	hypothetical protein	SSA_0276	Glycosyltransferase, family 2/glycosyltransferase family 8, putative	<-->	269648	269857	210	28.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
104	SSA_0279	Sugar-binding transcriptional repressor (DeoR), putative	SSA_0281	hypothetical protein	->->	273431	273543	113	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
105	SSA_0281	hypothetical protein	SSA_0282	Phosphotransferase system (PTS), cellobiose-specific IIA component, putative	->->	274024	274354	331	31.7%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
106	SSA_0284	Phosphotransferase system (PTS), cellobiose-specific IIC component, putative	SSA_0285	Formate acetyltransferase 3, putative	->->	276330	276497	168	29.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
107	SSA_0288	hypothetical protein	SSA_0289	Leucyl-tRNA synthetase, putative	<-->	281394	281545	152	30.3%	0	0	0	+: 1/1/0 \| -: 1/0/0	1	0	0	0	Result
108	SSA_0289	Leucyl-tRNA synthetase, putative	SSA_0290	hypothetical protein	-><-	284060	284173	114	29.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
109	SSA_0290	hypothetical protein	SSA_0291	Oxidoreductase, putative	<-->	285320	285501	182	33%	0	0	0	+: 1/3/0 \| -: 0/0/0	1	0	0	0	Result
110	SSA_0292	Transcriptional regulator, AraC family (arabinose operon control), putative	SSA_0293	hypothetical protein	-><-	287323	287445	123	43.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
112	SSA_0294	hypothetical protein	SSA_0295	Transcriptional regulator, LysR family, putative	<-<-	287967	288115	149	32.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
113	SSA_0295	Transcriptional regulator, LysR family, putative	SSA_0296	Transcriptional regulator, XRE family, putative	<-<-	288992	289102	111	36%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
114	SSA_0296	Transcriptional regulator, XRE family, putative	SSA_0297	Malolactic enzyme, putative	<-->	289454	289845	392	28.1%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
115	SSA_0298	Malate permease, putative	SSA_0299	hypothetical protein	->->	292508	292898	391	36.8%	0	0	3	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
116	SSA_0299	hypothetical protein	SSA_0300	hypothetical protein	->->	293403	293558	156	23.7%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
117	SSA_0301	hypothetical protein	SSA_0302	Phosphoglycerate kinase, putative	->->	294814	295029	216	31%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
118	SSA_0302	Phosphoglycerate kinase, putative	SSA_0303	surface protein C	->->	296227	296590	364	33.2%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
119	SSA_0303	surface protein C	SSA_0304	Bacterial cell wall degradation (CHAP/LysM domains), putative	->->	301112	301282	171	27.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
120	SSA_0304	Bacterial cell wall degradation (CHAP/LysM domains), putative	SSA_0305	hypothetical protein	->->	301949	302124	176	39.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
121	SSA_0313	Conserved uncharacterized protein	SSA_0314	Nucleoside-diphosphate-sugar epimerase, putative	<-<-	308710	309056	347	36%	0	0	0	+: 1/1/1 \| -: 0/2/0	1	0	0	0	Result
122	SSA_0314	Nucleoside-diphosphate-sugar epimerase, putative	SSA_0315	Transcriptional regulator, MarR family, putative	<-->	310110	310241	132	26.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
123	SSA_0320	hypothetical protein	SSA_0321	Methylase, putative	->->	313885	314006	122	32%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
124	SSA_0321	Methylase, putative	SSA_0322	Transcriptional activator, TipA family, putative	->->	314754	314856	103	35.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
125	SSA_0322	Transcriptional activator, TipA family, putative	SSA_0323	Flavoprotein, putative	-><-	315595	315713	119	32.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
126	SSA_0323	Flavoprotein, putative	SSA_0324	Conserved uncharacterized protein	<-->	316890	317158	269	32%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
127	SSA_0325	Membrane-anchored glycerophosphoryl diester phosphodiesterase, putative	SSA_0326	Conserved uncharacterized BCR, YbaB family	-><-	319498	319613	116	37.9%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
128	SSA_0326	Conserved uncharacterized BCR, YbaB family	SSA_0327	Glycosyltransferase, putative	<-->	319914	320118	205	32.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
129	SSA_0328	Xaa-Pro dipeptidyl-peptidase, putative	SSA_0329	Glycerol uptake facilitator/aquaporin protein, putative	<-->	322866	322969	104	22.1%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
130	SSA_0332	hypothetical protein	SSA_0333	Mevalonate kinase, putative	->->	326985	327134	150	37.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
131	SSA_0338	Hydroxymethylglutaryl-CoA synthase, putative	SSA_0339	hypothetical protein	<-<-	333429	333572	144	27.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
132	SSA_0341	hypothetical protein	SSA_0342	Pyruvate formate-lyase, putative	<-<-	334822	334980	159	35.2%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
133	SSA_0342	Pyruvate formate-lyase, putative	SSA_0343	DNA-damage-inducible protein P, putative	<-->	337297	337664	368	29.9%	0	0	0	+: 2/1/2 \| -: 2/1/1	1	0	0	0	Result
134	SSA_0343	DNA-damage-inducible protein P, putative	SSA_0345	hypothetical protein	->->	338730	338942	213	31%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
135	SSA_0345	hypothetical protein	SSA_0346	hypothetical protein	->->	339270	339587	318	36.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
136	SSA_0352	Ribonuclease HIII, putative	SSA_0353	Conserved uncharacterized protein	<-->	345970	346079	110	30.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
137	SSA_0357	Thioredoxin, putative	SSA_0358	hypothetical protein	-><-	351218	351377	160	36.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
138	SSA_0358	hypothetical protein	SSA_0359	Trancriptional regulator, LysR-family, putative	<-->	351888	352326	439	25.7%	0	0	69	+: 0/2/0 \| -: 1/1/0	1	0	0	0	Result
139	SSA_0359	Trancriptional regulator, LysR-family, putative	SSA_0360	Conserved uncharacterized protein	->->	352744	352843	100	22%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
140	SSA_0360	Conserved uncharacterized protein	SSA_0362	Thioredoxin, putative	->->	353252	353429	178	33.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
141	SSA_0362	Thioredoxin, putative	SSA_0363	D-alanine/glycine/Na permease, putative	->->	353655	353997	343	42%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
142	SSA_0364	Serine/threonine:Na+ symporter, putative	SSA_0365	Small-conductance mechanosensitive efflux channel, putative	<-->	356439	356760	322	46.3%	0	0	1	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
143	SSA_0366	hypothetical protein	SSA_0367	hypothetical protein	->->	358273	358448	176	35.2%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
144	SSA_0371	NADP-specific glutamate dehydrogenase, putative	SSA_0373	Dihydroorotate dehydrogenase, putative	<-->	361850	362201	352	33.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
145	SSA_0373	Dihydroorotate dehydrogenase, putative	SSA_0374	Peptide methionine sulfoxide reductase msrA/msrB, putative	->->	363141	363302	162	30.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
146	SSA_0374	Peptide methionine sulfoxide reductase msrA/msrB, putative	SSA_0375	D-methionine-binding lipoprotein (ABC-type transporter), putative	->->	364239	364396	158	25.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
147	SSA_0375	D-methionine-binding lipoprotein (ABC-type transporter), putative	SSA_0376	ABC-type methionine transporter, ATPase component, putative	->->	365270	365518	249	38.6%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
148	SSA_0377	ABC-type methionine transporter, permease component, putative	SSA_0378	TRZ/ATZ family hydrolase, putative	->->	367279	367415	137	39.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
149	SSA_0378	TRZ/ATZ family hydrolase, putative	SSA_0379	PTS system, beta-glucoside-specific EII component, putative	->->	368688	368961	274	35.4%	0	0	0	+: 1/1/0 \| -: 0/2/0	1	0	0	0	Result
150	SSA_0379	PTS system, beta-glucoside-specific EII component, putative	SSA_0380	Enzyme of poly-gamma-glutamate biosynthesis (capsule formation), putative	->->	370894	371055	162	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
151	SSA_0380	Enzyme of poly-gamma-glutamate biosynthesis (capsule formation), putative	SSA_0381	hypothetical protein	->->	372439	372902	464	33.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
152	SSA_0381	hypothetical protein	SSA_0382	Transcriptional regulator, AraC family (arabinose-binding/dimerisation), putative	-><-	373575	373689	115	28.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
153	SSA_0382	Transcriptional regulator, AraC family (arabinose-binding/dimerisation), putative	SSA_0383	Beta-glucosidase, putative	<-->	374563	374673	111	25.2%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
154	SSA_0383	Beta-glucosidase, putative	SSA_0384	hypothetical protein	->->	376114	376379	266	30.8%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
155	SSA_0384	hypothetical protein	SSA_0385	ABC transporter, glycine-betaine/proline permease protein, putative	-><-	378510	378615	106	40.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
156	SSA_0386	Glycine-betaine ABC transporter, ATPase component, putative	SSA_0387	Transcriptional regulator, GntR family, putative	<-<-	381546	381791	246	35.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
157	SSA_0387	Transcriptional regulator, GntR family, putative	SSA_0388	Mismatch repair ATPase (MutS family), putative	<-->	382434	382613	180	34.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
158	SSA_0390	hypothetical protein	SSA_0391	Pyruvate oxidase, putative	->->	385775	386085	311	28.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
159	SSA_0391	Pyruvate oxidase, putative	SSA_0392	hypothetical protein	->->	387862	388015	154	41.6%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	1	1	154	Result	ttcctctcgccgaaaatcaaatgtaaactgtgtcatcttaaccttgccgtacagcagtactgcctgcggttcgatgtcttgtttataacttgattttcttagagcggaacttgaaaagatcggagcaatccggtctttttatggaggatagtaa
160	SSA_0392	hypothetical protein	SSA_0393	Bacteriocin ABC-type exporter, ATP binding/permease protein, putative	->->	388364	388905	542	26.9%	0	0	0	+: 2/1/0 \| -: 1/2/0	1	0	0	0	Result
161	SSA_0393	Bacteriocin ABC-type exporter, ATP binding/permease protein, putative	SSA_0394	hypothetical protein	->->	390481	390712	232	25.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
162	SSA_0394	hypothetical protein	SSA_0395	6-phospho-beta-glucosidase, putative	->->	390992	391200	209	27.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	68	206	Result	agaggataatttttaaaaaatgatctgatcaacttaaatagtagaatagtatcagtatgtaacaatattttataagaaaaggtttacataatgagctataatataagtaaatgaacaagcaaataagaaagcgagtaga
163	SSA_0396	hypothetical protein	SSA_0397	hypothetical protein	<-<-	393686	394081	396	36.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
164	SSA_0400	hypothetical protein	SSA_0401	Two-component response transcriptional regulator (CheY-like receiver and winged-helix DNA-binding domains), putative	<-->	398342	398601	260	31.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
165	SSA_0402	Histidine kinase, putative	SSA_0403	CAAX amino terminal protease family, putative	->->	400160	400614	455	35.6%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
166	SSA_0403	CAAX amino terminal protease family, putative	SSA_0405	Transcriptional regulator, XRE family, putative	->->	401449	401557	109	33%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
167	SSA_0405	Transcriptional regulator, XRE family, putative	SSA_0406	hypothetical protein	-><-	402176	402285	110	37.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
168	SSA_0407	ABC-type multidrug transport system (3-component subtilin immunity exporter), ATPase component, putative	SSA_0408	hypothetical protein	<-<-	403934	404078	145	22.8%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
169	SSA_0409	ABC-type multidrug transport system, ATPase component, putative	SSA_0410	hypothetical protein	<-<-	405696	405839	144	30.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
170	SSA_0412	ABC-type multidrug transport system (3-component subtilin immunity exporter), ATPase component, putative	SSA_0413	Anthranilate/para-aminobenzoate synthases component I/ Chorismate binding enzyme, putative	<-<-	408254	408404	151	32.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
171	SSA_0413	Anthranilate/para-aminobenzoate synthases component I/ Chorismate binding enzyme, putative	SSA_0414	hypothetical protein	<-->	410127	410257	131	26%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
172	SSA_0415	Permease, putative	SSA_0416	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase, putative	->->	411791	412029	239	34.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
173	SSA_0416	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase, putative	SSA_0417	5,10-methylenetetrahydrofolate reductase, putative	->->	414283	414419	137	40.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
174	SSA_0418	AraC-type DNA-binding domain-containing protein, putative	SSA_0419	Alpha-galactosidase, putative	->->	416245	416352	108	36.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
175	SSA_0419	Alpha-galactosidase, putative	SSA_0420	Hydrolase, HAD superfamily, putative	->->	418591	418759	169	30.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
176	SSA_0425	Glycosyltransferase, putative	SSA_0426	hypothetical protein	<-<-	423370	423654	285	31.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
177	SSA_0426	hypothetical protein	SSA_0427	DNA-binding transcriptional activator, SARP family, putative	<-->	424477	424636	160	27.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
178	SSA_0428	Formimidoylglutamase, putative	SSA_0429	Histidine ammonia-lyase, putative	<-<-	428895	429790	896	37.7%	0	0	0	+: 0/3/0 \| -: 1/1/0	1	0	0	0	Result
179	SSA_0434	Glutamate formiminotransferase, putative	SSA_0435	Urocanate hydratase, putative	<-<-	436659	436778	120	37.5%	0	0	0	+: 1/0/0 \| -: 0/2/0	1	0	0	0	Result
180	SSA_0435	Urocanate hydratase, putative	SSA_0436	Imidazolonepropionase, putative	<-->	438810	439008	199	32.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
181	SSA_0436	Imidazolonepropionase, putative	SSA_0437	30S ribosomal protein S6, putative	->->	440275	440452	178	40.4%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
182	SSA_0441	hypothetical protein	SSA_0442	ABC-type multidrug transport system, ATPase component, putative	->->	442236	442376	141	29.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
183	SSA_0447	Magnesium and cobalt transporter, putative	SSA_0448	Excinuclease ATPase subunit A, putative	<-->	446492	446619	128	35.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
184	SSA_0448	Excinuclease ATPase subunit A, putative	SSA_0449	Aminopeptidase P; XAA-pro aminopeptidase, putative	->->	449452	449603	152	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
185	SSA_0452	Nitrogen utilization substance protein B, putative	SSA_0453	Type II secretory pathway, pullulanase PulA glycosidase, putative	->->	452121	452351	231	31.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
186	SSA_0455	Sucrose-6-phosphate hydrolase, putative	SSA_0456	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific, putative	<-->	458541	458734	194	26.3%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
187	SSA_0456	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific, putative	SSA_0457	Fructokinase, putative	->->	460646	460802	157	28%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
188	SSA_0459	hypothetical protein	SSA_0460	Multiple antibiotic resistance operon transcription repressor (MarR), putative	->->	462574	462747	174	31.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
189	SSA_0462	ABC-type multidrug transport system (phospholipid, LPS, lipid A and drug exporter), ATPase and permease components, putative	SSA_0463	Cobyrinic acid A,C-diamide synthase, putative	->->	466713	467004	292	31.5%	0	0	0	+: 1/1/0 \| -: 0/3/0	1	0	0	0	Result
190	SSA_0478	Cobalt transport protein cbiN, putative	SSA_0479	CbiQ protein, putative	->->	480448	480564	117	49.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
191	SSA_0492	NADH-dependent flavin oxidoreductase, putative	SSA_0493	ABC-type dipeptide/nickel transport system, periplasmic component, putative	->->	492832	493007	176	37.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
192	SSA_0498	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components, putative	SSA_0499	ABC-type dipeptide transport system, periplasmic component, putative	->->	498860	499054	195	32.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
193	SSA_0500	Peptide ABC transporter, permease protein, putative	SSA_0502	Peptide ABC transporter, permease protein, putative	->->	501585	501693	109	41.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
194	SSA_0506	Iron-sulfur cluster-binding protein, putative	SSA_0507	hypothetical protein	<-->	505720	505860	141	26.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
195	SSA_0507	hypothetical protein	SSA_0508	Conserved uncharacterized protein, possible phosphoserine phosphatase	->->	506503	506807	305	32.5%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
196	SSA_0513	ATP:cob(I)alamin adenosyltransferase, putative	SSA_0514	PduQ protein, putative	->->	512298	513016	719	33.1%	0	0	0	+: 1/2/2 \| -: 1/2/0	1	0	0	0	Result
197	SSA_0514	PduQ protein, putative	SSA_0515	Propanediol utilization protein PduU, putative	->->	514160	514273	114	30.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
199	SSA_0525	Microcompartment protein, putative	SSA_0526	hypothetical protein	->->	523903	524099	197	40.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
200	SSA_0531	Ethanolamine utilization protein eutQ (cobalamin-dependent degradation of ethanolamine), putative	SSA_0532	Propanediol utilization protein PduB, putative	->->	527945	528383	439	35.3%	0	0	0	+: 0/5/0 \| -: 1/3/0	1	0	0	0	Result
201	SSA_0539	PduO protein, putative	SSA_0540	Glycerol uptake facilitator protein, putative	->->	534928	535094	167	38.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
202	SSA_0540	Glycerol uptake facilitator protein, putative	SSA_0541	Acetate kinase, putative	->->	535809	535942	134	29.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
203	SSA_0541	Acetate kinase, putative	SSA_0543	SecA, putative	->->	537143	537418	276	33.7%	0	0	0	+: 1/2/2 \| -: 1/1/0	1	0	0	0	Result
204	SSA_0546	Phospho-2-dehydro-3-deoxyheptonate aldolase (DAHP synthatase), possibly tyr-sensitive, putative	SSA_0547	Acyl carrier protein synthase, putative	->->	542024	542130	107	48.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
205	SSA_0548	Alanine racemase, putative	SSA_0549	ATP-dependent DNA helicase recG, transcription-repair coupling factor, putative	->->	543590	543695	106	45.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
206	SSA_0549	ATP-dependent DNA helicase recG, transcription-repair coupling factor, putative	SSA_0551	L-asparaginase, putative	-><-	545712	546420	709	33.6%	0	0	0	+: 0/3/0 \| -: 0/2/0	1	0	0	0	Result
207	SSA_0551	L-asparaginase, putative	SSA_0552	Cof family protein, putative	<-->	547384	547563	180	26.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
208	SSA_0559	hypothetical protein	SSA_0560	hypothetical protein	->->	553180	553405	226	31.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
209	SSA_0561	RNA:NAD 2'-phosphotransferase, putative	SSA_0562	hypothetical protein	->->	554316	554607	292	28.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
210	SSA_0562	hypothetical protein	SSA_0563	Universal stress protein family, putative	-><-	554920	555036	117	35.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
211	SSA_0563	Universal stress protein family, putative	SSA_0564	Potential aminotransferase, putative	<-->	555490	555833	344	34.6%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
212	SSA_0564	Potential aminotransferase, putative	SSA_0565	hypothetical protein	->->	557049	557369	321	32.4%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
213	SSA_0565	hypothetical protein	SSA_0566	GTP-sensing transcriptional pleiotropic repressor, putative	->->	559956	560156	201	20.9%	0	0	0	+: 1/0/0 \| -: 0/2/0	1	0	0	0	Result
214	SSA_0567	Isochorismitase family protein, putative	SSA_0568	Aspartyl-tRNA synthetase 1, putative	->->	561503	561813	311	45.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
215	SSA_0568	Aspartyl-tRNA synthetase 1, putative	SSA_0569	Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C, putative	->->	563551	563752	202	36.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
216	SSA_0571	Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B, putative	SSA_0572	Dehydrogenase, putative	->->	566955	567565	611	30.8%	0	0	0	+: 3/2/3 \| -: 0/1/0	1	0	0	0	Result
217	SSA_0574	YdjX protein, putative	SSA_0575	Hydrolase, HAD superfamily, putative	<-->	569518	569666	149	33.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
218	SSA_0576	Conserved GTPase, putative	SSA_0577	Ancient RNA-binding IF3-C fold (CRS1/YhbY domain), putative	->->	571286	571392	107	43%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
219	SSA_0583	Nucleotidyltransferase, putative	SSA_0584	hypothetical protein	->->	575740	575945	206	36.4%	0	0	0	+: 1/2/0 \| -: 0/0/0	1	0	0	0	Result
220	SSA_0584	hypothetical protein	SSA_0585	hypothetical protein	->->	576750	577076	327	40.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
221	SSA_0585	hypothetical protein	SSA_0586	Conserved uncharacterized protein	->->	577347	577586	240	32.9%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
222	SSA_0586	Conserved uncharacterized protein	SSA_0587	Metal-dependent amidase/aminoacylase/carboxypeptidase, putative	->->	578304	578678	375	38.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
223	SSA_0587	Metal-dependent amidase/aminoacylase/carboxypeptidase, putative	SSA_0588	L-cystine ABC transporter, substrate-binding component, putative	->->	579822	579939	118	30.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
224	SSA_0588	L-cystine ABC transporter, substrate-binding component, putative	SSA_0589	Acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase (M20/M25/M40 family peptidase), putative	->->	580768	580884	117	42.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
225	SSA_0592	hypothetical protein	SSA_0593	Rhodanese-like sulfurtransferase, putative	->->	584309	584624	316	27.2%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
226	SSA_0593	Rhodanese-like sulfurtransferase, putative	SSA_0594	Transcriptional regulator, AraC family, putative	->->	585612	585769	158	29.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
227	SSA_0596	hypothetical protein	SSA_0597	hypothetical protein	->->	587413	587705	293	32.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
228	SSA_0597	hypothetical protein	SSA_0599	hypothetical protein	->->	588624	588806	183	34.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
229	SSA_0599	hypothetical protein	SSA_0601	Phosphorylase, Pnp/Udp family, putative	->->	589068	589286	219	42%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
230	SSA_0609	Transcriptional regulator, TetR/AcrR family, putative	SSA_0610	LemA-like protein, putative	<-->	598955	599107	153	28.1%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
231	SSA_0611	HtpX protease, putative	SSA_0612	Rgg protein, putative	->->	600576	601035	460	27.2%	0	0	0	+: 1/2/2 \| -: 0/0/0	1	0	0	0	Result
232	SSA_0613	Glucosyltransferase, putative	SSA_0614	Transporter, putative	-><-	606694	606822	129	28.7%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
233	SSA_0614	Transporter, putative	SSA_0615	RggD, putative	<-<-	608065	608415	351	34.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
235	SSA_0617	Membrane protease subunits, stomatin/prohibitin-like protein (SPFH domain/band 7 family), putative	SSA_0618	hypothetical protein	-><-	611499	611769	271	34.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
236	SSA_0622	Transcriptional regulator (XRE family), SOS-response transcriptional repressors (RecA-mediated autopeptidases), putative	SSA_0623	hypothetical protein	<-->	614510	614651	142	35.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
237	SSA_0626	hypothetical protein	SSA_0627	hypothetical protein	->->	617273	617453	181	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
238	SSA_0629	hypothetical protein	SSA_0631	Tryptophan synthase beta chain, putative	->->	619647	620011	365	36.2%	0	0	0	+: 1/1/0 \| -: 0/0/0	2	0	0	0	Result
239	SSA_0631	Tryptophan synthase beta chain, putative	SSA_0632	Anthranilate synthase component I, putative	->->	621194	621597	404	41.1%	0	0	0	+: 2/2/2 \| -: 1/1/1	1	0	0	0	Result
240	SSA_0651	hypothetical protein	SSA_0652	UDP-N-acetylmuramoylalanine--D-glutamate ligase, putative	->->	634958	635175	218	27.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
241	SSA_0654	Cell division protein DivIB, putative	SSA_0655	Cell division protein FtsA, putative	->->	638803	638923	121	31.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
243	SSA_0660	Cell division protein DivIVA, putative	SSA_0661	Isoleucyl-tRNA synthetase, putative	->->	644733	645015	283	39.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
244	SSA_0661	Isoleucyl-tRNA synthetase, putative	SSA_0662	Multiple antibiotic resistance operon transcription repressor (MarR), putative	-><-	647809	647936	128	28.1%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
245	SSA_0669	ATP dependent protease, putative	SSA_0670	Conserved uncharacterized protein	<-->	653811	654059	249	29.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
246	SSA_0670	Conserved uncharacterized protein	SSA_0671	Methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase, putative	->->	654291	654479	189	30.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
247	SSA_0672	hypothetical protein	SSA_0673	hypothetical protein	->->	656105	656211	107	43%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
248	SSA_0673	hypothetical protein	SSA_0674	Exodeoxyribonuclease VII large subunit, putative	->->	657055	657210	156	32.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
249	SSA_0680	Serine/threonine protein phosphatase, putative	SSA_0682	Conserved uncharacterized protein	->->	663294	663577	284	30.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
250	SSA_0682	Conserved uncharacterized protein	SSA_0683	DNA-binding protein HU, putative	->->	664412	664523	112	28.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
251	SSA_0683	DNA-binding protein HU, putative	SSA_0684	Fibril-like structure subunit FibA, putative	->->	664800	665131	332	28.9%	0	0	0	+: 1/2/2 \| -: 0/1/0	1	0	0	0	Result
252	SSA_0684	Fibril-like structure subunit FibA, putative	SSA_0685	hypothetical protein	->->	668954	669171	218	26.6%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
253	SSA_0685	hypothetical protein	SSA_0686	Fe2+/Zn2+ uptake regulation protein, putative	->->	669493	669695	203	35.5%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
254	SSA_0686	Fe2+/Zn2+ uptake regulation protein, putative	SSA_0687	hypothetical protein	->->	670140	670606	467	36.6%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
255	SSA_0687	hypothetical protein	SSA_0688	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase, putative	->->	671351	671499	149	36.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
256	SSA_0688	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase, putative	SSA_0689	Penicillin-binding protein 2B, putative	->->	672193	672401	209	36.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
257	SSA_0689	Penicillin-binding protein 2B, putative	SSA_0690	Recombinational DNA repair protein (RecF pathway), putative	->->	674469	674571	103	35.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
258	SSA_0690	Recombinational DNA repair protein (RecF pathway), putative	SSA_0691	D-ala,D-ala ligase, putative	->->	675169	675372	204	36.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
259	SSA_0694	Mutator protein, putative	SSA_0695	hypothetical protein	->->	678482	678588	107	31.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
260	SSA_0696	hypothetical protein	SSA_0697	hypothetical protein	->->	679981	680222	242	38.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
261	SSA_0697	hypothetical protein	SSA_0698	Peptide chain release factor 3, putative	->->	680337	680522	186	30.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
262	SSA_0698	Peptide chain release factor 3, putative	SSA_0699	Methyltransferase, putative	->->	682068	682355	288	33.3%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
263	SSA_0700	hypothetical protein	SSA_0701	Cation transporter CorA family, putative	->->	683401	684507	1107	35%	0	0	1	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
264	SSA_0701	Cation transporter CorA family, putative	SSA_0702	Aconitase A, putative	->->	685417	685627	211	24.6%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
265	SSA_0705	hypothetical protein	SSA_0706	RNA helicase, putative	<-->	691041	691502	462	34.6%	0	0	3	+: 0/2/0 \| -: 1/0/0	1	0	0	0	Result
266	SSA_0706	RNA helicase, putative	SSA_0707	Lactose phosphotransferase system transcriptional repressor, putative	->->	692970	693354	385	33.2%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
267	SSA_0707	Lactose phosphotransferase system transcriptional repressor, putative	SSA_0708	hypothetical protein	->->	694102	694283	182	33.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
268	SSA_0711	hypothetical protein	SSA_0712	P-type ATPase-metal cation transport (calcium efflux), putative	<-<-	696722	696850	129	36.4%	0	0	0	+: 0/0/0 \| -: 1/2/2	1	0	0	0	Result
269	SSA_0712	P-type ATPase-metal cation transport (calcium efflux), putative	SSA_0713	1-acyl-sn-glycerol-3-phosphate acyltransferase, putative	<-->	699191	699347	157	31.8%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
270	SSA_0714	hypothetical protein	SSA_0715	DNA uptake protein, putative	->->	700710	700865	156	28.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
271	SSA_0716	Competence protein, putative	SSA_0718	Conserved uncharacterized protein	->->	703771	703900	130	26.9%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
272	SSA_0718	Conserved uncharacterized protein	SSA_0720	hypothetical protein	->->	704996	705245	250	30.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
273	SSA_0722	hypothetical protein	SSA_0723	hypothetical protein	->->	708176	708385	210	28.1%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
274	SSA_0723	hypothetical protein	SSA_0724	ABC-type multidrug/protein/lipid transport system (pediocin PA-1 exporter), ATPase and permease components, putative	->->	708527	708791	265	31.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
275	SSA_0725	hypothetical protein	SSA_0726	FmtA-like protein, putative	->->	710873	711044	172	30.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
276	SSA_0727	Metal-dependent membrane protease, putative	SSA_0728	Protease, putative	->->	713700	713827	128	39.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
277	SSA_0729	hypothetical protein	SSA_0730	Arsenical resistance operon transcription repressor (ArsR), putative	->->	714738	714957	220	36.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
279	SSA_0736	Catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases, putative	SSA_0737	Arginine deiminase, putative	->->	718475	718763	289	25.6%	0	0	0	+: 1/0/0 \| -: 2/1/1	1	0	0	0	Result
280	SSA_0738	Ornithine carbamoyltransferase, catabolic, putative	SSA_0739	Carbamate kinase, putative	->->	721061	721226	166	34.3%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
281	SSA_0739	Carbamate kinase, putative	SSA_0740	C4-dicarboxylate anaerobic carrier, possible arginine transporter, putative	->->	722175	722379	205	34.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
282	SSA_0741	Acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase, putative	SSA_0743	Transcriptional repressor (arginine synthesis), putative	-><-	725251	725378	128	35.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
283	SSA_0746	Glucosamine-6-phosphate deaminase, putative	SSA_0747	DD-carboxypeptidase, putative	->->	727926	728075	150	28.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
284	SSA_0748	Sugar:H+ symporter, permease of the major facilitator superfamily, putative	SSA_0749	Competence protein, putative	->->	730696	730807	112	33.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
285	SSA_0749	Competence protein, putative	SSA_0750	hypothetical protein	->->	731759	731928	170	28.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
286	SSA_0750	hypothetical protein	SSA_0751	Oligoendopeptidase F, putative	->->	732316	732506	191	29.3%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
287	SSA_0752	hypothetical protein	SSA_0753	Foldase protein prsA precursor, putative	->->	734995	735107	113	23%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
288	SSA_0753	Foldase protein prsA precursor, putative	SSA_0755	hypothetical protein	->->	736116	736351	236	40.3%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	4	26	194	Result	tataataagactggtgagaattgatttttcaagttcttagttcagagaattggcggtgctgcgagccatctgagacggagaatcatgctactcatcttgaaaaatagaatacgaaatgagaatgacaagttcattgaatgaaggtggtaccgcggtttttcgcccttcg
289	SSA_0756	Alanyl-tRNA synthetase, putative	SSA_0757	N-acetyl-gamma-glutamyl-phosphate reductase, putative	->->	739495	739735	241	30.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
290	SSA_0760	Acetylornithine aminotransferase, putative	SSA_0761	Transcriptional regulator, XRE family, putative	->->	743864	744016	153	25.5%	0	0	0	+: 1/2/0 \| -: 2/0/0	1	0	0	0	Result
291	SSA_0766	hypothetical protein	SSA_0767	Diacylglycerol kinase catalytic domain protein, putative	->->	747036	747226	191	35.1%	0	0	0	+: 1/1/1 \| -: 0/2/0	1	0	0	0	Result
292	SSA_0767	Diacylglycerol kinase catalytic domain protein, putative	SSA_0768	Ribonucleoside-diphosphate reductase 2, beta subunit, putative	-><-	748115	748225	111	35.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
293	SSA_0770	Ribonucleoside-diphosphate reductase, putative	SSA_0771	Glutaredoxin-like protein, putative	<-<-	751502	751661	160	38.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
294	SSA_0771	Glutaredoxin-like protein, putative	SSA_0772	Histidine-containing phosphocarrier protein of the PTS, putative	<-->	751881	752477	597	28.1%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
295	SSA_0773	PTS enzyme I, putative	SSA_0774	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, putative	->->	754477	754710	234	25.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
296	SSA_0774	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, putative	SSA_0775	1,4-alpha-glucan branching enzyme, putative	->->	756136	756520	385	27.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
297	SSA_0778	Glycogen synthase, putative	SSA_0779	Glycogen phosphorylase, putative	->->	762137	762348	212	38.2%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
298	SSA_0779	Glycogen phosphorylase, putative	SSA_0780	Acid phosphatase (PAP2 family), putative	->->	764746	764887	142	38%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
299	SSA_0780	Acid phosphatase (PAP2 family), putative	SSA_0781	Mannose-6-phosphate isomerase, putative	->->	765389	765512	124	37.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
300	SSA_0781	Mannose-6-phosphate isomerase, putative	SSA_0782	Proton-translocating ATPase, F0 sector, subunit c, putative	->->	766455	766718	264	23.9%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
302	SSA_0789	Proton-translocating ATPase, F1 sector, epsilon subunit, putative	SSA_0790	hypothetical protein	->->	773014	773186	173	38.2%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
303	SSA_0793	DNA-entry nuclease, putative	SSA_0794	Zn-dependent protease, putative	->->	775860	776035	176	31.2%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
304	SSA_0796	ABC-NBD transporters with duplicated ATPase domains, putative	SSA_0797	Transcriptional regulator, putative	->->	779121	779660	540	36.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
305	SSA_0801	Mur ligase family protein, putative	SSA_0802	hypothetical protein	<-->	784208	784439	232	29.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
306	SSA_0804	Phosphoglucomutase/phosphomannomutase family protein, putative	SSA_0805	Collagen-binding surface protein, putative	->->	787488	787615	128	25%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
307	SSA_0805	Collagen-binding surface protein, putative	SSA_0806	hypothetical protein	->->	789293	789409	117	31.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
308	SSA_0808	hypothetical protein	SSA_0809	Translation initiation inhibitor, yjgF family / endoribonuclease L-PSP, putative	->->	791073	791285	213	31.9%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
309	SSA_0813	Thioredoxin reductase, putative	SSA_0814	Oxidoreductase, pyridine nucleotide-disulfide, class I, putative	<-<-	795497	795608	112	30.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
310	SSA_0814	Oxidoreductase, pyridine nucleotide-disulfide, class I, putative	SSA_0815	hypothetical protein	<-->	796926	797114	189	30.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
311	SSA_0815	hypothetical protein	SSA_0816	Copper transport operon or penicillinase transcription repressor, putative	->->	797472	797584	113	29.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
312	SSA_0817	Antirepressor regulating drug resistance (membrane-bound), putative	SSA_0818	SPX domain-like protein, putative	->->	799436	799814	379	33.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
313	SSA_0819	hypothetical protein	SSA_0820	Ribosomal protein S21, putative	->->	801242	801388	147	34%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
314	SSA_0820	Ribosomal protein S21, putative	SSA_0822	Large conductance mechano-sensitive ion channel, putative	-><-	801566	801678	113	36.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
315	SSA_0822	Large conductance mechano-sensitive ion channel, putative	SSA_0824	DNA primase (bacterial type), putative	<-->	802063	802192	130	21.5%	0	0	0	+: 2/0/0 \| -: 2/0/0	1	0	0	0	Result
316	SSA_0825	DNA-directed RNA polymerase, sigma subunit (sigma70/sigma32), putative	SSA_0826	hypothetical protein	->->	805117	805237	121	46.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
317	SSA_0826	hypothetical protein	SSA_0827	Conserved uncharacterized cytosolic protein, putative	->->	805577	806172	596	39.3%	0	0	0	+: 2/1/0 \| -: 0/0/0	1	17	62	430	Result	tataatgttcttattgtcttggggtcgttacggattcgacaggcattatgaggcacattttgcgactcatctagcggatgtaaaacgccagttaaatataactgcaaaaaataacaattcttacgctttagctgcctaaaaaccagccagcgtgacccgattcggattgcttgtgtctgatgacaggtcttattatgagcaagctacggcaaagtctagtctagggattttgcaagagattgatagactcgcttgacttgggcttgagctatgtgtcaaagtgaagttaaaccaatacatagcctatggttgtagacaaatgtgttagcaggtgtttggacgtgggttcgactcccaccggctccatta
319	SSA_0829	Platelet-binding glycoprotein	SSA_0830	Glycosyltransferase, putative	->->	812226	812569	344	32.8%	0	0	0	+: 1/2/2 \| -: 0/1/0	1	0	0	0	Result
320	SSA_0841	hypothetical protein	SSA_0842	Effector of murein hydrolase LrgA/holin-like protein, putative	->->	827297	827469	173	34.1%	0	0	0	+: 0/3/0 \| -: 0/2/0	1	0	0	0	Result
321	SSA_0848	Pyruvate kinase I, fructose-stimulated, putative	SSA_0849	Signal peptidase I, putative	->->	836085	836266	182	33%	0	0	0	+: 1/0/0 \| -: 0/2/0	1	0	0	0	Result
322	SSA_0849	Signal peptidase I, putative	SSA_0850	Ubiquitin C-terminal hydrolase, putative	->->	836825	836957	133	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
323	SSA_0851	Cation efflux family protein, putative	SSA_0852	ATP-dependent DNA helicase, putative	<-->	838991	839189	199	35.2%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
324	SSA_0857	hypothetical protein	SSA_0858	DTDP-L-rhamnose synthase, putative	->->	845543	845651	109	27.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
325	SSA_0858	DTDP-L-rhamnose synthase, putative	SSA_0859	Triosephosphate isomerase, putative	->->	846507	846780	274	34.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
326	SSA_0859	Triosephosphate isomerase, putative	SSA_0860	N-acetylmuramidase/lysin, putative	->->	847546	847754	209	38.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
327	SSA_0864	hypothetical protein	SSA_0865	hypothetical protein	<-->	856409	856517	109	30.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
328	SSA_0865	hypothetical protein	SSA_0866	Cation-transporting ATPase, E1-E 2 family, putative	->->	856911	857122	212	34.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
329	SSA_0868	hypothetical protein	SSA_0869	Peptide chain release factor 2, putative	<-->	861626	862053	428	34.1%	0	0	0	+: 2/2/2 \| -: 1/0/0	1	3	305	424	Result	gtatttatggacatttcagaaattcgtcaaaagattgacgcaaatcgtgaaaaattagcttctttcagggggtctctttgacttagaaggtctggaagaagaaattgccatcttagaaaa
330	SSA_0872	Zn-dependent hydrolases, including glyoxylases, putative	SSA_0873	ATP-dependent DNA helicase; DNA polymerase III, epsilon subunit, putative	<-->	865396	865530	135	32.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
331	SSA_0876	4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative	SSA_0877	Phosphoglycolate phosphatase, putative	->->	870922	871147	226	35.4%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
332	SSA_0885	hypothetical protein	SSA_0886	Enolase, putative	<-->	879605	879812	208	26.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
333	SSA_0886	Enolase, putative	SSA_0887	hypothetical protein	-><-	881118	881254	137	32.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
334	SSA_0887	hypothetical protein	SSA_0888	Magnesium/cobalt transporter, putative	<-->	881357	881468	112	33%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
335	SSA_0891	3-carboxymuconate cyclase, putative	SSA_0892	ATP-binding cassette lipoprotein, putative	<-->	884124	884365	242	32.6%	0	0	0	+: 0/3/0 \| -: 0/0/0	1	0	0	0	Result
336	SSA_0900	Tetratricopeptide repeat (TPR) family protein	SSA_0901	Alpha-acetolactate decarboxylase, putative	->->	892438	892586	149	34.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
337	SSA_0903	NAD(P)H dehydrogenase (quinone), putative	SSA_0904	CshA-like fibrillar surface protein A	->->	893874	894045	172	31.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
338	SSA_0904	CshA-like fibrillar surface protein A	SSA_0905	CshA-like fibrillar surface protein B	->->	903019	903219	201	23.9%	0	0	0	+: 1/0/0 \| -: 0/2/0	1	0	0	0	Result
339	SSA_0905	CshA-like fibrillar surface protein B	SSA_0906	CshA-like fibrillar surface protein C	->->	909121	909461	341	22%	0	0	0	+: 1/2/2 \| -: 1/1/0	1	0	0	0	Result
340	SSA_0906	CshA-like fibrillar surface protein C	SSA_0907	Fibronectin-binding protein A, putative	-><-	917472	917657	186	36.6%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
341	SSA_0907	Fibronectin-binding protein A, putative	SSA_0908	ABC-type uncharacterized transport system, periplasmic component, putative	<-->	919308	919839	532	33.8%	0	0	0	+: 1/2/0 \| -: 0/0/0	2	0	0	0	Result
342	SSA_0908	ABC-type uncharacterized transport system, periplasmic component, putative	SSA_0909	Transcriptional regulator, AbrB family (stationary/sporulation gene expression), putative	->->	920848	921026	179	36.9%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
343	SSA_0909	Transcriptional regulator, AbrB family (stationary/sporulation gene expression), putative	SSA_0910	ABC-type multidrug transporter, ATPase component, putative	->->	921219	921495	277	28.9%	0	0	0	+: 1/1/0 \| -: 1/0/0	1	0	0	0	Result
344	SSA_0911	hypothetical protein	SSA_0912	Phenylalanyl-tRNA synthetase alpha chain, putative	->->	922959	923239	281	42.7%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	3	77	243	Result	aatagcaatccgcaagaccagtaacctaggggaagtttaacagggaggggagccagcgactgaaagctctctagatgaaagctaggcgaattcacttgctatgggattgataagtaaggtctggcttgccagataaaaaacggatggtaccgcgtgtcaacgctccg
345	SSA_0913	Acetyltransferase, putative	SSA_0914	Phenylalanyl-tRNA synthetase beta chain, putative	->->	924845	925091	247	35.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
346	SSA_0914	Phenylalanyl-tRNA synthetase beta chain, putative	SSA_0915	hypothetical protein	->->	927498	927681	184	37.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
347	SSA_0915	hypothetical protein	SSA_0916	2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase, putative	->->	928075	928224	150	38%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
348	SSA_0916	2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase, putative	SSA_0917	Cobalamin-independent methionine synthase II, putative	-><-	929053	929176	124	33.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
349	SSA_0917	Cobalamin-independent methionine synthase II, putative	SSA_0918	Conserved uncharacterized protein	<-->	930341	930537	197	31.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
350	SSA_0922	hypothetical protein	SSA_0923	Transcriptional regulator, TetR/AcrR family, putative	<-->	933041	933149	109	34.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
351	SSA_0923	Transcriptional regulator, TetR/AcrR family, putative	SSA_0924	ABC-type antimicrobial peptide transport system, permease component, putative	->->	933759	933877	119	37.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
352	SSA_0926	Histone acetyltransferase HPA2, putative	SSA_0927	Transcriptional regulator, TetR/AcrR family, putative	->->	936022	936188	167	31.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
353	SSA_0931	hypothetical protein	SSA_0932	hypothetical protein	->->	941396	941592	197	31.5%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
354	SSA_0935	tRNA pseudouridine synthase B, putative	SSA_0936	FAD synthase, putative	->->	945034	945278	245	33.9%	0	0	0	+: 2/2/2 \| -: 0/1/0	1	0	0	0	Result
355	SSA_0936	FAD synthase, putative	SSA_0937	Arsenate reductase, glutaredoxin family, putative	->->	946212	946322	111	24.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
356	SSA_0940	NOL1/NOP2/sun family protein, putative	SSA_0941	ABC-type phosphate transport system, periplasmic component, putative	->->	949071	949296	226	33.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
357	SSA_0946	Phosphate transport system regulatory protein, putative	SSA_0947	hypothetical protein	->->	954187	954342	156	29.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
358	SSA_0947	hypothetical protein	SSA_0948	hypothetical protein	->->	954937	955094	158	29.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
359	SSA_0948	hypothetical protein	SSA_0949	hypothetical protein	->->	955689	955846	158	25.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	2	0	0	0	Result
360	SSA_0954	hypothetical protein	SSA_0955	Aminopeptidase N, putative	->->	958491	958658	168	36.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
361	SSA_0955	Aminopeptidase N, putative	SSA_0956	surface protein D	->->	961200	961362	163	27.6%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
362	SSA_0956	surface protein D	SSA_0957	Dehydrogenase, putative	->->	965479	966415	937	33.7%	0	5	34	+: 1/2/1 \| -: 0/1/0	1	0	0	0	Result
363	SSA_0957	Dehydrogenase, putative	SSA_0958	hypothetical protein	->->	967232	967412	181	29.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
364	SSA_0958	hypothetical protein	SSA_0959	Two-component response transcriptional regulator (CheY-like receiver domain and a winged-helix DNA-binding domains), putative	->->	967878	967981	104	26%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
365	SSA_0961	Possible ketopantoate reductase PanE/ApbA, putative	SSA_0962	Lactoylglutathione lyase, putative	->->	970992	971104	113	27.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
366	SSA_0966	Uridine kinase, putative	SSA_0967	hypothetical protein	->->	975851	976011	161	42.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
367	SSA_0967	hypothetical protein	SSA_0968	hypothetical protein	->->	976681	976838	158	31%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
368	SSA_0968	hypothetical protein	SSA_0969	hypothetical protein	->->	977202	977351	150	26%	0	0	0	+: 0/1/0 \| -: 0/0/0	2	0	0	0	Result
369	SSA_0969	hypothetical protein	SSA_0970	hypothetical protein	->->	977790	977929	140	25%	0	0	0	+: 0/1/0 \| -: 0/0/0	2	0	0	0	Result
370	SSA_0973	hypothetical protein	SSA_0975	2-isopropylmalate synthase, putative	->->	980748	981110	363	34.4%	0	0	0	+: 1/4/0 \| -: 0/1/0	1	0	0	0	Result
371	SSA_0983	Conserved uncharacterized protein	SSA_0984	SlyA-like protein, putative	->->	987006	987193	188	30.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
372	SSA_0987	ABC-type choline transporter, membrane-spanning permease, putative	SSA_0988	TfoX N-terminal domain family protein, putative	->->	990655	990801	147	34.7%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
373	SSA_0991	Deoxyribonuclease, putative	SSA_0992	hypothetical protein	<-->	993433	993625	193	27.5%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
374	SSA_0994	Peptidase E, putative	SSA_0995	Antibiotic-resistance protein, alpha/beta superfamily hydrolase, putative	->->	995451	995855	405	33.8%	0	0	6	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
375	SSA_1005	Sugar ABC transporter, permease protein, putative	SSA_1006	Dextransucrase, putative	->->	1007002	1007215	214	39.7%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
376	SSA_1007	ABC transporter ATP-binding protein-multiple sugar transport, putative	SSA_1008	Galactokinase, putative	->->	1009820	1009995	176	23.3%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
377	SSA_1008	Galactokinase, putative	SSA_1009	Galactose-1-phosphate-uridylyltransferase, putative	->->	1011175	1011393	219	44.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	2	1	79	191	Result	ggttgagtgggctctattacgctgatttcatcagcttttacagccctaatcaactgtgcggaggtgggacgacgaaatcgaattctaacgaattaccgatttctgtcccactc
378	SSA_1010	UDP-glucose 4-epimerase, putative	SSA_1011	hypothetical protein	->->	1013923	1014273	351	29.1%	0	0	0	+: 2/0/0 \| -: 0/1/0	1	0	0	0	Result
379	SSA_1017	hypothetical protein	SSA_1018	Zinc metalloprotease zmpC precursor, putative	->->	1023280	1023485	206	22.3%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
380	SSA_1018	Zinc metalloprotease zmpC precursor, putative	SSA_1019	Collagen-binding surface protein, putative	->->	1032630	1033016	387	26.4%	0	0	0	+: 0/3/0 \| -: 1/3/0	1	0	0	0	Result
381	SSA_1019	Collagen-binding surface protein, putative	SSA_1020	hypothetical protein	->->	1035438	1035696	259	28.6%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
382	SSA_1020	hypothetical protein	SSA_1021	Conserved uncharacterized protein	->->	1036165	1036283	119	34.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
383	SSA_1024	Alpha-amylase, putative	SSA_1026	ABC-type multidrug transporter, ATPase component, putative	<-->	1042739	1042933	195	30.8%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
384	SSA_1028	Transcriptional repressor, XRE family, putative	SSA_1029	hypothetical protein	<-<-	1046154	1046256	103	27.2%	0	0	0	+: 0/2/0 \| -: 1/0/0	1	0	0	0	Result
385	SSA_1029	hypothetical protein	SSA_1030	Transcriptional regulator, TetR family, putative	<-->	1047100	1047233	134	29.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
386	SSA_1038	Lipoprotein, putative	SSA_1039	Sugar ABC transporter, ATP-binding protein, putative	->->	1053775	1053913	139	36.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
387	SSA_1041	Sugar ABC transporter, permease protein, putative	SSA_1042	Xylanase/chitin deacetylase, putative	-><-	1057495	1057598	104	35.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
389	SSA_1044	Homoserine kinase, putative	SSA_1045	hypothetical protein	->->	1060860	1060980	121	34.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
390	SSA_1045	hypothetical protein	SSA_1047	UDP-N-acetylenolpyruvoylglucosamine reductase, putative	->->	1061893	1061999	107	25.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
391	SSA_1047	UDP-N-acetylenolpyruvoylglucosamine reductase, putative	SSA_1048	ABC transporter ATP-binding protein-spermidine/putrescine transport, putative	->->	1062906	1063086	181	44.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
392	SSA_1052	hypothetical protein	SSA_1053	Pyruvate phosphate dikinase, putative	<-<-	1067353	1067536	184	28.3%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
393	SSA_1053	Pyruvate phosphate dikinase, putative	SSA_1054	CBS domain protein, putative	<-->	1070159	1070403	245	24.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
394	SSA_1056	Firmicute fructose-1,6-bisphosphatase, putative	SSA_1057	Aminotransferase, class-V, putative	->->	1073811	1073910	100	32%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
395	SSA_1060	hypothetical protein	SSA_1061	50S ribosomal protein L21, putative	->->	1077508	1077731	224	41.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	3	75	224	Result	tgctatacttatagagttgactatgcacattcctgtgcaaccgcacgatcatcgttgctcactctgtgagatagaagtggttcgtcccacgatgctaggcgagtcttcacaaaatccggggaaaccccaaaaaatcataggaggtgcata
397	SSA_1062	50S ribosomal protein L27, putative	SSA_1063	Peptidoglycan-binding domain-containing protein, putative	->->	1078718	1078967	250	27.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
398	SSA_1064	hypothetical protein	SSA_1065	Beta-hexosamidase A, putative	<-->	1081156	1081397	242	24%	0	0	0	+: 2/0/0 \| -: 2/0/0	1	0	0	0	Result
399	SSA_1065	Beta-hexosamidase A, putative	SSA_1066	ABC-type oligopeptide transport system, putative	->->	1084191	1084474	284	33.5%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
400	SSA_1066	ABC-type oligopeptide transport system, putative	SSA_1067	hypothetical protein	->->	1086437	1086538	102	36.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
401	SSA_1070	Ribosomal large subunit pseudouridine synthase D, putative	SSA_1072	Glutamate 5-kinase, putative	->->	1089779	1089894	116	34.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
402	SSA_1074	Pyrroline-5-carboxylate reductase, putative	SSA_1075	Coproporphyrinogen III oxidase, putative	->->	1093095	1093232	138	28.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
403	SSA_1079	hypothetical protein	SSA_1080	Transcriptional repressor of the fructose operon, DeoR family, putative	->->	1097509	1097677	169	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
404	SSA_1082	PTS system, fructose specific II ABC components, putative	SSA_1083	Conserved uncharacterized protein	->->	1101312	1101437	126	34.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
405	SSA_1087	ABC-type transporter (antibiotic resistance protein), ATPase component, putative	SSA_1088	hypothetical protein	->->	1106533	1107187	655	32.7%	0	0	0	+: 0/3/0 \| -: 0/0/0	1	0	0	0	Result
406	SSA_1090	Glucokinase, putative	SSA_1091	Thymidylate synthase, putative	->->	1108671	1108774	104	35.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
407	SSA_1091	Thymidylate synthase, putative	SSA_1092	Dihydrofolate reductase, putative	->->	1109615	1109738	124	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
409	SSA_1094	GTP-binding protein, putative	SSA_1095	Peptidoglycan hydrolase, putative	->->	1112304	1112449	146	24.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
410	SSA_1096	Methyltransferase, putative	SSA_1098	Formate-nitrate transporter, putative	->->	1114160	1114273	114	21.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
411	SSA_1098	Formate-nitrate transporter, putative	SSA_1099	Calcium binding hemolysin-like protein, putative	->->	1115072	1115500	429	27.7%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
412	SSA_1101	Multidrug resistance efflux pump/hemolysin secretion transmembrane protein, putative	SSA_1102	hypothetical protein	->->	1123260	1123525	266	28.9%	0	0	0	+: 2/1/1 \| -: 0/0/0	1	0	0	0	Result
413	SSA_1102	hypothetical protein	SSA_1103	hypothetical protein	->->	1123868	1123972	105	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
415	SSA_1105	50S ribosomal protein L7/ L12, putative	SSA_1106	IgA-specific metalloendopeptidase	->->	1125826	1126113	288	27.8%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
416	SSA_1106	IgA-specific metalloendopeptidase	SSA_1107	Lipid/multidrug/protein-type ABC exporter, ATP binding/membrane-spanning protein, putative	->->	1131739	1132107	369	35%	0	0	0	+: 1/4/2 \| -: 0/2/0	1	0	0	0	Result
417	SSA_1110	hypothetical protein	SSA_1111	Branched-chain amino acid transport system II carrier protein, putative	->->	1136246	1136671	426	25.8%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
418	SSA_1111	Branched-chain amino acid transport system II carrier protein, putative	SSA_1112	Cell wall surface anchor family protein, putative	->->	1138001	1138220	220	27.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
419	SSA_1114	Histidine kinase, putative	SSA_1115	Cytochrome C-type biogenesis protein, putative	->->	1141612	1141753	142	26.1%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
420	SSA_1120	Two-component sensor kinase (with C-terminal ATPase domain), putative	SSA_1121	Cytochrome C-type biogenesis protein, putative	->->	1147066	1147288	223	30.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
421	SSA_1125	NADPH-dependent FMN reductase, putative	SSA_1126	Thiamine biosynthesis lipoprotein, putative	<-<-	1150505	1150676	172	33.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
422	SSA_1126	Thiamine biosynthesis lipoprotein, putative	SSA_1127	H2O-forming NADH dehydrogenase, putative	<-->	1151613	1151870	258	30.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
423	SSA_1127	H2O-forming NADH dehydrogenase, putative	SSA_1128	Voltage gated chloride channel EriC, putative	->->	1153248	1153389	142	31%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
424	SSA_1128	Voltage gated chloride channel EriC, putative	SSA_1129	Periplasmic iron transport lipoprotein, putative	->->	1154947	1155064	118	28.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
426	SSA_1134	Xanthine phosphoribosyltransferase, putative	SSA_1135	Na+-driven multidrug efflux pump, putative	->->	1160377	1160491	115	30.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
427	SSA_1135	Na+-driven multidrug efflux pump, putative	SSA_1136	ATPases with chaperone activity, ATP-binding subunit, putative	->->	1161836	1162063	228	25.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
428	SSA_1136	ATPases with chaperone activity, ATP-binding subunit, putative	SSA_1137	Dihydrolipoamide dehydrogenase, putative	->->	1164308	1164514	207	33.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
429	SSA_1140	Dihydrolipoamide acetyl transferase, E2 component, putative	SSA_1143	Na+-driven multidrug efflux pump, putative	-><-	1169268	1172237	2970	36.7%	0	0	69	+: 3/7/3 \| -: 0/6/0	1	0	0	0	Result
430	SSA_1143	Na+-driven multidrug efflux pump, putative	SSA_1144	Beta-N-acetylhexosaminidase, putative	<-<-	1173588	1173738	151	36.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
431	SSA_1145	hypothetical protein	SSA_1146	Phosphotransferase system cellobiose-specific component IIA, putative	<-->	1176222	1176592	371	30.2%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
432	SSA_1150	Tautomerase, putative	SSA_1151	Thymidine kinase, putative	<-->	1180167	1180289	123	22%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
433	SSA_1157	PvaA-like protein, putative	SSA_1158	hypothetical protein	->->	1186279	1186392	114	26.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
434	SSA_1158	hypothetical protein	SSA_1161	hypothetical protein	->->	1187248	1187522	275	36.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
435	SSA_1163	GMP synthase [glutamine-hydrolyzing], putative	SSA_1164	hypothetical protein	<-<-	1190989	1191096	108	32.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
436	SSA_1165	Transcriptional regulator, GntR family, putative	SSA_1166	hypothetical protein	->->	1191926	1192068	143	31.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
437	SSA_1166	hypothetical protein	SSA_1167	SRP54, signal recognition particle GTPase protein, putative	->->	1192411	1192656	246	39.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
438	SSA_1168	hypothetical protein	SSA_1169	Conserved hypothetical protein with an alpha/beta hydrolase fold, putative	->->	1195983	1196090	108	25.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
439	SSA_1169	Conserved hypothetical protein with an alpha/beta hydrolase fold, putative	SSA_1170	hypothetical protein	-><-	1196907	1197022	116	25%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
440	SSA_1170	hypothetical protein	SSA_1171	Tyrosine recombinase xerC	<-->	1198052	1198227	176	20.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
441	SSA_1172	hypothetical protein	SSA_1173	Lipoate protein ligase A, putative	<-<-	1200017	1200181	165	33.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
442	SSA_1175	Acetoin dehydrogenase complex, E2 component, dihydrolipoamide acetyltransferase, putative	SSA_1176	Acetoin dehydrogenase, E1 component, beta subunit, putative	<-<-	1204067	1204526	460	32.6%	0	0	0	+: 1/3/3 \| -: 1/7/0	1	1	129	236	Result	catgatactaaggcgttaaaaatcaaagtgaaaatagaaaacttaacgaagaaattttcgtttctagaaaagtttatctttttcacacagactttagcccatgttcaa
443	SSA_1178	Acetoin dehydrogenase, E1 component, alpha subunit, putative	SSA_1179	Carbamoylphosphate synthase large subunit / biotin carboxylase, putative	<-<-	1206508	1206729	222	29.7%	0	0	0	+: 0/1/0 \| -: 1/1/1	1	0	0	0	Result
444	SSA_1181	Hydrolase, alpha/beta superfamily, putative	SSA_1182	Gid-like protein, putative	<-<-	1209507	1209621	115	17.4%	0	0	0	+: 1/2/0 \| -: 0/0/0	1	0	0	0	Result
445	SSA_1182	Gid-like protein, putative	SSA_1183	hypothetical protein	<-<-	1210957	1211057	101	34.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
447	SSA_1189	GTP-binding protein, putative	SSA_1190	Conserved uncharacterized protein	<-<-	1217748	1217888	141	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
448	SSA_1191	hypothetical protein	SSA_1192	hypothetical protein	<-<-	1218414	1218524	111	31.5%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
449	SSA_1194	Aspartate-semialdehyde dehydrogenase, putative	SSA_1196	Acetyltransferase, GNAT family, putative	<-<-	1221280	1221617	338	37%	0	0	0	+: 1/0/0 \| -: 1/1/1	1	0	0	0	Result
450	SSA_1200	Formate--tetrahydrofolate ligase, putative	SSA_1201	hypothetical protein	<-->	1225682	1225894	213	27.2%	0	0	0	+: 1/1/1 \| -: 3/1/0	1	0	0	0	Result
451	SSA_1203	hypothetical protein	SSA_1204	Phosphoglucomutase	->->	1227689	1227926	238	31.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
452	SSA_1204	Phosphoglucomutase	SSA_1205	Bta, putative	->->	1229646	1229769	124	30.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
453	SSA_1211	hypothetical protein	SSA_1212	Ribose-phosphate pyrophosphokinase 2, putative	->->	1235405	1235540	136	30.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
454	SSA_1214	Conserved uncharacterized Lactobacillales protein	SSA_1215	hypothetical protein	->->	1237970	1238085	116	35.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
455	SSA_1215	hypothetical protein	SSA_1216	AT-rich DNA-binding protein, possible redox-sensing transcriptional repressor, putative	->->	1238308	1238431	124	29%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
456	SSA_1218	DNA repair protein radC, putative	SSA_1219	Sortase, putative	<-<-	1240550	1240671	122	30.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
457	SSA_1220	DNA gyrase A subunit, putative	SSA_1221	L-lactate dehydrogenase, putative	<-->	1243923	1244095	173	30.1%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
459	SSA_1224	hypothetical protein	SSA_1225	Branched-chain amino acid aminotransferase, putative	<-<-	1247572	1247678	107	36.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
460	SSA_1225	Branched-chain amino acid aminotransferase, putative	SSA_1226	ParC, putative	<-<-	1248699	1248872	174	30.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
461	SSA_1226	ParC, putative	SSA_1227	Aminoglycoside adenylyltransferase, putative	<-<-	1251324	1251568	245	30.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	7	5	231	Result	gatacagagcccgtaaaatacaaagtgaaaataggaaattcttacagtgagcgatgctcacaagagaatttatctttttcacacagtatttagggcgtgttcaactcctttcaaagaatgtagagtagttttttataaaataaaggatattttacgaaaattagtcccgtgttcaattactataagtaaccaaactatcctttctgtagttttaatgttttaaatta
463	SSA_1230	Conserved uncharacterized protein	SSA_1231	hypothetical protein	<-<-	1253449	1253738	290	33.4%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
464	SSA_1232	Topoisomerase IV subunit B, putative	SSA_1233	Membrane protein, YqiH family, putative	<-->	1256846	1257035	190	30.5%	0	0	0	+: 1/1/1 \| -: 1/0/0	1	0	0	0	Result
465	SSA_1234	5'-nucleotidase, putative	SSA_1235	Dihydroorotase, putative	<-<-	1259886	1260048	163	27%	0	0	0	+: 0/2/0 \| -: 1/0/0	1	0	0	0	Result
466	SSA_1239	hypothetical protein	SSA_1240	Orotate phosphoribosyltransferase, putative	<-<-	1264780	1264890	111	34.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
467	SSA_1241	Orotidine-5'-phosphate decarboxylase, putative	SSA_1242	Dihydroorotate dehydrogenase B, putative	<-<-	1266292	1266537	246	37.4%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
468	SSA_1243	Dihydroorotate dehydrogenase electron transfer subunit, putative	SSA_1244	hypothetical protein	<-<-	1268295	1268554	260	41.2%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
469	SSA_1245	Transcriptional regulator, LysR family, putative	SSA_1246	hypothetical protein	-><-	1269771	1269887	117	41.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
470	SSA_1252	hypothetical protein	SSA_1253	hypothetical protein	<-<-	1277596	1281065	3470	44.8%	0	0	0	+: 0/1/0 \| -: 2/7/5	1	0	0	0	Result
471	SSA_1255	hypothetical protein	SSA_1256	NAD-dependent deacetylase, putative	<-<-	1282335	1282446	112	20.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
472	SSA_1258	Purine nucleoside phosphorylase, family 1, putative	SSA_1259	Purine nucleoside phosphorylase, putative	<-<-	1284743	1284999	257	36.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
473	SSA_1261	Ribose-5-phosphate isomerase A, putative	SSA_1262	tRNA modification GTPase, possibly iron-binding, putative	<-->	1287745	1287921	177	32.8%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
474	SSA_1268	Chorismate mutase/prephenate dehydratase, putative	SSA_1269	hypothetical protein	<-<-	1291701	1292059	359	39.8%	0	0	0	+: 0/2/0 \| -: 2/6/10	1	0	0	0	Result
475	SSA_1269	hypothetical protein	SSA_1270	Flavodoxin	<-<-	1293443	1293565	123	39%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
476	SSA_1270	Flavodoxin	SSA_1271	Conserved uncharacterized protein	<-->	1294007	1294111	105	26.7%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
477	SSA_1271	Conserved uncharacterized protein	SSA_1272	50S ribosomal protein L31 type B, putative	->->	1295048	1295154	107	30.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
478	SSA_1272	50S ribosomal protein L31 type B, putative	SSA_1274	hypothetical protein	-><-	1295398	1295606	209	31.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
479	SSA_1275	hypothetical protein	SSA_1276	Conserved uncharacterized protein	<-<-	1297697	1298245	549	23.5%	0	0	0	+: 0/3/0 \| -: 2/0/0	1	0	0	0	Result
480	SSA_1277	D-alanyl-D-alanine carboxypeptidase	SSA_1278	Rhodanese-like domain protein, putative	<-<-	1299307	1299652	346	33.2%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
481	SSA_1279	Oxidoreductase, putative	SSA_1280	hypothetical protein	<-<-	1300923	1301197	275	42.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
482	SSA_1283	Nitroreductase, putative	SSA_1284	hypothetical protein	<-<-	1304427	1304535	109	28.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
483	SSA_1285	hypothetical protein	SSA_1286	hypothetical protein	<-<-	1305560	1305848	289	26.6%	0	0	0	+: 0/1/0 \| -: 1/1/1	2	0	0	0	Result
484	SSA_1287	hypothetical protein	SSA_1288	hypothetical protein	<-<-	1306828	1307185	358	28.8%	0	0	0	+: 0/1/0 \| -: 1/2/2	2	0	0	0	Result
486	SSA_1289	hypothetical protein	SSA_1291	hypothetical protein	<-<-	1308476	1309080	605	28.8%	0	0	2	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
487	SSA_1296	hypothetical protein	SSA_1297	Nuclease subunit of the excinuclease complex, subunit C, putative	<-<-	1313104	1313230	127	26%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
488	SSA_1297	Nuclease subunit of the excinuclease complex, subunit C, putative	SSA_1298	Maltose/maltodextrin ABC transporter, sugar-binding protein MalX, putative	<-->	1315067	1315430	364	26.6%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
489	SSA_1300	Maltose ABC transporter, permease protein, putative	SSA_1301	Conserved uncharacterized protein, possible surface protein	-><-	1318964	1319099	136	24.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
490	SSA_1301	Conserved uncharacterized protein, possible surface protein	SSA_1302	tRNA (Guanine-N(1)-)-methyltransferase, putative	<-<-	1321662	1321851	190	25.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
491	SSA_1305	hypothetical protein	SSA_1306	Trk transporter NAD+ binding protein-K+ transport, putative	<-<-	1324170	1324334	165	35.2%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
492	SSA_1308	hypothetical protein	SSA_1309	RNA-binding protein (KH domain), putative	<-<-	1326909	1327168	260	42.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
493	SSA_1310	30S ribosomal protein S16, putative	SSA_1311	Hydrolase, haloacid dehalogenase-like family, putative	<-<-	1327701	1327931	231	28.1%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
494	SSA_1311	Hydrolase, haloacid dehalogenase-like family, putative	SSA_1312	RADC-like protein, putative	<-<-	1328484	1328826	343	37.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
495	SSA_1313	hypothetical protein	SSA_1314	Fe-S-cluster oxidoreductase, putative	<-<-	1330639	1330835	197	38.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
496	SSA_1314	Fe-S-cluster oxidoreductase, putative	SSA_1315	hypothetical protein	<-<-	1331331	1331497	167	30.5%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
497	SSA_1315	hypothetical protein	SSA_1316	Nicotinamide mononucleotide transporter, putative	<-<-	1332143	1332246	104	29.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
498	SSA_1316	Nicotinamide mononucleotide transporter, putative	SSA_1317	hypothetical protein	<-<-	1333039	1333487	449	29.8%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
499	SSA_1317	hypothetical protein	SSA_1318	GTP-binding protein lepA, putative	<-<-	1333635	1334078	444	34.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
500	SSA_1318	GTP-binding protein lepA, putative	SSA_1319	hypothetical protein	<-->	1335912	1336024	113	30.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
501	SSA_1321	Ferrochelatase, putative	SSA_1322	Glycosyl transferase, putative	<-<-	1338434	1338625	192	30.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
502	SSA_1325	Ketoacyl reductase hetN, putative	SSA_1326	Peptidase T, putative	<-->	1342434	1342571	138	29%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
503	SSA_1328	hypothetical protein	SSA_1329	Conserved uncharacterized protein	<-<-	1344987	1345115	129	29.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
504	SSA_1330	hypothetical protein	SSA_1331	Conserved uncharacterized protein	<-<-	1346459	1346562	104	35.6%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
505	SSA_1336	Conserved ankyrin repeat protein, putative	SSA_1337	hypothetical protein	<-<-	1350217	1350581	365	28.8%	0	0	1	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
507	SSA_1338	hypothetical protein	SSA_1339	Pneumococcal histidine triad protein D precursor, putative	<-<-	1351818	1351968	151	29.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
508	SSA_1340	Zn/Mn ABC-type porter lipoprotein, putative	SSA_1341	Carbamoyl-phosphate synthase large chain, putative	<-<-	1356463	1356737	275	30.5%	0	0	0	+: 0/1/0 \| -: 1/2/1	1	0	0	0	Result
509	SSA_1343	Aspartate carbamoyltransferase, putative	SSA_1344	Xanthine/uracil permeases, putative	<-<-	1362050	1362158	109	40.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
510	SSA_1345	Bifunctional pyrimidine operon transcriptional attenuation protein/uracil phosphoribosyltransferase, putative	SSA_1346	hypothetical protein	<-<-	1363970	1364240	271	31%	0	0	0	+: 0/1/0 \| -: 1/2/0	1	0	0	0	Result
511	SSA_1347	PhnA protein, putative	SSA_1348	hypothetical protein	<-->	1365232	1365494	263	33.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
512	SSA_1349	Transcriptional regulator, biotin repressor family, putative	SSA_1350	hypothetical protein	-><-	1366574	1367034	461	31.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
513	SSA_1356	Helicase subunit of the DNA excision repair complex, subunit B, putative	SSA_1357	hypothetical protein	<-<-	1372006	1372166	161	37.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
514	SSA_1358	hypothetical protein	SSA_1359	Arginine/histidine ABC transporter, permease component, putative	<-->	1374127	1374321	195	32.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
517	SSA_1371	FmtA-like protein, putative	SSA_1372	hypothetical protein	<-<-	1388923	1389035	113	31%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
518	SSA_1372	hypothetical protein	SSA_1373	ATPase components of ABC transporters with duplicated ATPase domains, multidrug transport system, putative	<-->	1389228	1389846	619	30%	0	0	0	+: 3/3/0 \| -: 1/2/1	1	0	0	0	Result
519	SSA_1376	Transport protein, putative	SSA_1377	Asparaginyl-tRNA synthetase, putative	<-<-	1396202	1396357	156	32.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
520	SSA_1378	hypothetical protein	SSA_1379	hypothetical protein	<-<-	1398089	1398267	179	36.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
521	SSA_1381	hypothetical protein	SSA_1382	hypothetical protein	<-<-	1399656	1399886	231	35.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
522	SSA_1382	hypothetical protein	SSA_1383	Aspartate aminotransferase, putative	<-<-	1400361	1400626	266	35.3%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
523	SSA_1384	hypothetical protein	SSA_1385	Multiple antibiotic resistance operon transcription repressor (MarR), putative	<-->	1402294	1402407	114	24.6%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
524	SSA_1389	hypothetical protein	SSA_1390	hypothetical protein	<-<-	1405003	1405722	720	29.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
525	SSA_1396	hypothetical protein	SSA_1397	hypothetical protein	<-->	1410465	1410728	264	36.4%	0	0	2	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
526	SSA_1408	hypothetical protein	SSA_1409	DTDP-glucose-4,6-dehydratase, putative	<-<-	1421096	1421298	203	34.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
527	SSA_1409	DTDP-glucose-4,6-dehydratase, putative	SSA_1410	DTDP-4-keto-6-deoxyglucose-3,5-epimerase, putative	<-<-	1422346	1422582	237	33.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
528	SSA_1417	SAM-dependent methyltransferase, putative	SSA_1418	Conserved uncharacterized protein	<-<-	1428084	1428228	145	37.2%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
529	SSA_1420	Homoserine O-succinyltransferase, putative	SSA_1421	Adenine phosphoribosyltransferase, putative	<-<-	1430716	1430862	147	28.6%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
530	SSA_1423	Single-stranded DNA-specific exonuclease, 5'-3', putative	SSA_1424	Hydrolase, putative	<-<-	1433874	1433978	105	38.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
531	SSA_1424	Hydrolase, putative	SSA_1428	hypothetical protein	<-<-	1434570	1435727	1158	42.4%	0	0	10	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
532	SSA_1434	Conserved uncharacterized Firmicutes protein	SSA_1435	hypothetical protein	-><-	1441161	1441840	680	37.9%	0	0	0	+: 2/0/0 \| -: 1/2/0	1	0	0	0	Result
533	SSA_1440	Phosphoribosyl-ATP pyrophosphohydrolase, putative	SSA_1441	Phosphoribosyl-AMP cyclohydrolase, putative	<-<-	1444812	1444928	117	31.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
534	SSA_1449	Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase, putative	SSA_1450	hypothetical protein	<-<-	1452022	1452494	473	38.9%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
535	SSA_1452	Second subunit of major exonuclease, putative	SSA_1453	hypothetical protein	<-<-	1459787	1459986	200	39.5%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
536	SSA_1456	hypothetical protein	SSA_1457	Neopullulanase, putative	<-<-	1462440	1462574	135	28.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
537	SSA_1457	Neopullulanase, putative	SSA_1458	hypothetical protein	<-<-	1464330	1464558	229	29.3%	0	0	0	+: 0/0/0 \| -: 1/1/1	1	0	0	0	Result
538	SSA_1458	hypothetical protein	SSA_2384	Acetyltransferase, GNAT family, putative	<-<-	1465438	1465557	120	30.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
539	SSA_2384	Acetyltransferase, GNAT family, putative	SSA_1459	RNA methyltransferase, putative	<-<-	1465987	1466200	214	45.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
540	SSA_1464	3-phosphoshikimate 1-carboxyvinyltransferase, putative	SSA_1465	Conserved uncharacterized protein	<-<-	1471607	1471737	131	33.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
541	SSA_1471	hypothetical protein	SSA_1472	hypothetical protein	<-<-	1478235	1478574	340	29.7%	0	0	0	+: 0/0/0 \| -: 1/2/2	1	0	0	0	Result
542	SSA_1473	hypothetical protein	SSA_1474	Lipoprotein, putative	<-<-	1479011	1479156	146	34.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
543	SSA_1474	Lipoprotein, putative	SSA_1475	hypothetical protein	<-<-	1479832	1480064	233	28.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
544	SSA_1475	hypothetical protein	SSA_1476	Phosphoglycerol transferase, alkaline phosphatase superfamily, putative	<-->	1480212	1480312	101	31.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
548	SSA_1481	FmtA-like protein, putative	SSA_1482	Pullulanase, putative	<-<-	1486713	1487038	326	39.9%	0	60	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
549	SSA_1484	DNA ligase, putative	SSA_1485	Citrulline cluster-linked gene, putative	<-<-	1492279	1492383	105	34.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
550	SSA_1485	Citrulline cluster-linked gene, putative	SSA_1486	hypothetical protein	<-->	1492900	1493061	162	42.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
552	SSA_1494	Conserved uncharacterized protein	SSA_1495	S-adenosylmethionine synthetase, putative	<-<-	1500864	1501108	245	32.2%	0	0	0	+: 1/0/0 \| -: 1/1/1	1	0	0	0	Result
553	SSA_1495	S-adenosylmethionine synthetase, putative	SSA_1496	hypothetical protein	<-<-	1502300	1502562	263	29.7%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
554	SSA_1496	hypothetical protein	SSA_1497	DCMP deaminase, putative	<-<-	1502995	1503157	163	33.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
555	SSA_1497	DCMP deaminase, putative	SSA_1498	50S ribosomal protein L20, putative	<-<-	1503626	1503842	217	29%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
556	SSA_1500	Translation initiation factor IF-3, putative	SSA_1501	Cytidylate kinase, putative	<-<-	1505012	1505184	173	40.5%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
557	SSA_1510	Rhamnosyltransferase, putative	SSA_1511	Glycosyltransferase, putative	<-<-	1515427	1515539	113	36.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
558	SSA_1519	Polysaccharide/teichoic acid transporter, putative	SSA_1520	Elongation factor Tu, putative	<-<-	1526160	1526474	315	34%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
559	SSA_1520	Elongation factor Tu, putative	SSA_1521	Phosphoenolpyruvate carboxylase, putative	<-<-	1527672	1527926	255	28.2%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	5	7	107	Result	aaaagcctccaataaaatatattttatagatagacagtaggcaatacagtctaactttccttactattttatcaaatttaaatgaaaatgcaagtctttta
560	SSA_1522	Cell division protein FtsW, putative	SSA_1523	Glutathione peroxidase, putative	<-->	1532053	1532206	154	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
561	SSA_1523	Glutathione peroxidase, putative	SSA_1525	Lyzozyme M1 (1,4-beta-N-acetylmuramidase), putative	->->	1532681	1532885	205	27.8%	0	0	0	+: 2/1/1 \| -: 0/1/0	1	0	0	0	Result
562	SSA_1525	Lyzozyme M1 (1,4-beta-N-acetylmuramidase), putative	SSA_1526	hypothetical protein	->->	1533744	1533861	118	31.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
563	SSA_1528	Phosphoglycerate mutase, putative	SSA_1529	Lysyl-tRNA synthetase, putative	->->	1535911	1536010	100	30%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
564	SSA_1533	Glutathione reductase, putative	SSA_1535	hypothetical protein	-><-	1542273	1542546	274	28.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
565	SSA_1535	hypothetical protein	SSA_1536	Biotin synthase, putative	<-->	1543279	1543748	470	32.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
566	SSA_1541	Peptidase, U32 family, putative	SSA_1542	Peptidase, U32 family, putative	<-<-	1546691	1546914	224	23.2%	0	0	0	+: 1/0/0 \| -: 1/1/1	1	0	0	0	Result
567	SSA_1543	hypothetical protein	SSA_1544	Conserved uncharacterized protein	-><-	1548278	1548403	126	34.1%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
568	SSA_1547	HPr kinase/phosphorylase, putative	SSA_1548	NTP pyrophosphohydrolases including oxidative damage repair enzymes, putative	<-<-	1551071	1551208	138	26.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
569	SSA_1548	NTP pyrophosphohydrolases including oxidative damage repair enzymes, putative	SSA_1549	hypothetical protein	<-<-	1551701	1551905	205	28.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
570	SSA_1549	hypothetical protein	SSA_1550	hypothetical protein	<-<-	1552203	1552317	115	30.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
571	SSA_1551	Transcriptional accessory ribonuclease (YqgFc, S1), putative	SSA_1552	hypothetical protein	<-->	1554875	1555052	178	25.8%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
572	SSA_1554	hypothetical protein	SSA_1555	Glucose-6-phosphate 1-dehydrogenase, putative	->->	1556908	1557081	174	32.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
573	SSA_1561	Ribonuclease III, putative	SSA_1562	hypothetical protein	<-<-	1565974	1566094	121	36.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
574	SSA_1565	Two-component response transcriptional regulator (CheY-like receiver and winged-helix DNA-binding domains), putative	SSA_1566	Polar amino acid ABC transporter, ATP-binding protein, putative	<-->	1569400	1569738	339	30.4%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
575	SSA_1569	ABC transporter membrane-spanning permease, arginine/histidine transport, putative	SSA_1570	hypothetical protein	->->	1572691	1572798	108	35.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
576	SSA_1570	hypothetical protein	SSA_1571	Threonyl-tRNA synthetase, putative	-><-	1573198	1573300	103	31.1%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
577	SSA_1572	hypothetical protein	SSA_1573	hypothetical protein	<-<-	1575999	1576143	145	40.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
578	SSA_1576	Catabolite control protein A, putative	SSA_1577	Proline dipeptidase, putative	<-->	1580272	1580433	162	29.6%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
579	SSA_1577	Proline dipeptidase, putative	SSA_1578	ABC-type Fe3+-siderophore transport system, permease component, putative	->->	1581517	1581942	426	32.2%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
580	SSA_1582	Esterase, alpha/beta hydrolase superfamily, putative	SSA_1583	6-O-methylguanine-DNA methyltransferase, putative	-><-	1585504	1585612	109	34.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
581	SSA_1585	hypothetical protein	SSA_1586	hypothetical protein	<-<-	1587695	1587819	125	26.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
582	SSA_1589	ABC-type antimicrobial peptide transport system, ATPase component, putative	SSA_1590	Transcriptional regulator, TetR/AcrR family, putative	<-->	1592699	1592841	143	26.6%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
583	SSA_1591	Dipeptidase, putative	SSA_1592	hypothetical protein	<-<-	1595542	1595665	124	26.6%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
584	SSA_1593	Dipeptidase, putative	SSA_1594	Metalloendopeptidase, putative	<-<-	1598145	1598546	402	34.8%	0	0	0	+: 1/0/0 \| -: 1/4/4	1	0	0	0	Result
585	SSA_1594	Metalloendopeptidase, putative	SSA_1595	Tellurite resistance, putative	<-<-	1600617	1601040	424	33.3%	0	0	0	+: 1/1/0 \| -: 1/1/1	1	0	0	0	Result
586	SSA_1595	Tellurite resistance, putative	SSA_1596	hypothetical protein	<-<-	1601905	1602164	260	34.6%	0	0	0	+: 0/1/0 \| -: 1/2/2	1	0	0	0	Result
587	SSA_1596	hypothetical protein	SSA_1597	hypothetical protein	<-<-	1603125	1603356	232	37.1%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
588	SSA_1598	hypothetical protein	SSA_1599	hypothetical protein	<-<-	1605329	1605531	203	37.4%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
589	SSA_1603	hypothetical protein	SSA_1604	Protein-export membrane protein secG, putative	<-<-	1610125	1610287	163	33.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
591	SSA_1608	hypothetical protein	SSA_1610	hypothetical protein	<-<-	1613844	1614093	250	40.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
592	SSA_1610	hypothetical protein	SSA_1611	Era-like GTP-binding protein, putative	<-<-	1615000	1615222	223	33.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
594	SSA_1614	Acetyltransferase, GNAT family, putative	SSA_1615	Alanine dehydrogenase, putative	<-->	1618136	1618265	130	30.8%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
595	SSA_1616	PhoH-like protein, putative	SSA_1617	hypothetical protein	<-<-	1620349	1620525	177	37.3%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
596	SSA_1618	hypothetical protein	SSA_1619	Ribosome recycling factor, putative	<-<-	1621665	1621768	104	35.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
597	SSA_1620	Uridylate kinase, putative	SSA_1621	Amino acid transporter, putative	<-<-	1623072	1623261	190	31.6%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
598	SSA_1621	Amino acid transporter, putative	SSA_1622	50S ribosomal protein L1, putative	<-<-	1624714	1624841	128	28.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
599	SSA_1622	50S ribosomal protein L1, putative	SSA_1623	50S ribosomal protein L11, putative	<-<-	1625532	1625632	101	41.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
600	SSA_1623	50S ribosomal protein L11, putative	SSA_1624	hypothetical protein	<-->	1626059	1626209	151	28.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
601	SSA_1624	hypothetical protein	SSA_1625	Lactoylglutathione lyase, putative	-><-	1626558	1626666	109	42.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
602	SSA_1625	Lactoylglutathione lyase, putative	SSA_1626	DNA translocase ftsK, putative	<-<-	1627054	1627166	113	39.8%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
603	SSA_1626	DNA translocase ftsK, putative	SSA_1627	hypothetical protein	<-<-	1629468	1629597	130	31.5%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
604	SSA_1627	hypothetical protein	SSA_1628	MutT/nudix family protein, putative	<-->	1629781	1630003	223	31.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
605	SSA_1630	hypothetical protein	SSA_1631	Sortase-like protein, putative	-><-	1631569	1631740	172	27.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
606	SSA_1635	hypothetical protein	SSA_1636	ABC-type antibiotic exporter, ATPase component, putative	<-<-	1639312	1639453	142	28.9%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
607	SSA_1636	ABC-type antibiotic exporter, ATPase component, putative	SSA_1638	hypothetical protein	<-<-	1640996	1641106	111	37.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
609	SSA_1643	hypothetical protein	SSA_1644	hypothetical protein	<-<-	1645360	1645560	201	36.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
610	SSA_1651	hypothetical protein	SSA_1652	Acetyltransferases, putative	<-<-	1649944	1650044	101	35.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
611	SSA_1658	Cationic amino acid transporter, putative	SSA_1659	ABC-type antimicrobial peptide transport system, permease component, putative	<-<-	1654765	1654920	156	33.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
612	SSA_1660	ABC-type antimicrobial peptide transport system, ATPase component, putative	SSA_1661	hypothetical protein	<-<-	1657671	1657848	178	36.5%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
613	SSA_1661	hypothetical protein	SSA_1662	NADH-dependent oxidoreductase, putative	<-<-	1658095	1658324	230	33%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
614	SSA_1662	NADH-dependent oxidoreductase, putative	SSA_1663	Collagen-binding protein A	<-<-	1659513	1659675	163	34.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
615	SSA_1663	Collagen-binding protein A	SSA_1664	Phosphatidylethanolamine N-methyltransferase, putative	<-<-	1664212	1664538	327	32.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
616	SSA_1666	Collagen-binding surface protein, putative	SSA_1667	hypothetical protein	<-<-	1667403	1667608	206	33.5%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
617	SSA_1669	hypothetical protein	SSA_1670	Transcriptional regulator, TetR/AcrR family, putative	<-<-	1668533	1668726	194	26.8%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
618	SSA_1670	Transcriptional regulator, TetR/AcrR family, putative	SSA_1671	hypothetical protein	<-->	1669339	1669443	105	25.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
619	SSA_1679	ABC-type multidrug transport system, ATPase component, putative	SSA_1680	ABC-type bacitracin resistance protein A, permease component, putative	<-<-	1673140	1673289	150	40%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
620	SSA_1681	ABC-type bacitracin resistance protein A, ATPase component, putative	SSA_1682	hypothetical protein	<-<-	1676051	1676219	169	39.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
621	SSA_1682	hypothetical protein	SSA_1683	NrdI protein, putative	<-<-	1676976	1677123	148	31.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
622	SSA_1685	Two-component response transcriptional regulator (CheY-like receiver and winged-helix DNA-binding domains), putative	SSA_1686	hypothetical protein	<-->	1679167	1679315	149	32.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
623	SSA_1686	hypothetical protein	SSA_1687	NADH-binding ferric-oxidoreductase, putative	->->	1680531	1680686	156	30.8%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
624	SSA_1687	NADH-binding ferric-oxidoreductase, putative	SSA_1689	hypothetical protein	-><-	1681884	1682034	151	36.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
625	SSA_1689	hypothetical protein	SSA_1690	hypothetical protein	<-->	1682596	1682880	285	23.2%	0	0	0	+: 2/0/0 \| -: 2/0/0	1	0	0	0	Result
626	SSA_1695	Transcriptional antiterminator, BglG/SacY family (induction of sugar metabolism), putative	SSA_1696	Tagatose 1,6-diphosphate aldolase 2, putative	<-<-	1688101	1688296	196	35.2%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
627	SSA_1701	Transcriptional repressor of sugar metabolism, GlpR/DeoR family, putative	SSA_1702	hypothetical protein	<-<-	1692145	1692286	142	27.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
628	SSA_1702	hypothetical protein	SSA_1703	Methionyl-tRNA synthetase, putative	<-<-	1693553	1693729	177	29.9%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
629	SSA_1703	Methionyl-tRNA synthetase, putative	SSA_1704	Conserved uncharacterized protein	<-<-	1695731	1695858	128	25%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
630	SSA_1712	Arsenate reductase (ArsC), glutaredoxin family, putative	SSA_1713	D-3-phosphoglycerate dehydrogenase, putative	<-<-	1700175	1700298	124	48.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
631	SSA_1715	Phosphoserine aminotransferase, putative	SSA_1716	Restriction endonuclease SsuRB, putative	<-<-	1702579	1702779	201	24.4%	0	0	0	+: 0/1/0 \| -: 1/1/1	1	0	0	0	Result
633	SSA_1718	Site-specific DNA-methyltransferase, putative	SSA_1719	Conserved uncharacterized protein	<-<-	1705902	1706013	112	22.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
634	SSA_1722	Thymidylate kinase, putative	SSA_1723	hypothetical protein	<-->	1708754	1709065	312	29.8%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
635	SSA_1724	CBS domain protein, putative	SSA_1725	Branched-chain amino acid ABC transporter, ATP-binding protein, putative	<-<-	1710644	1711082	439	34.4%	0	0	0	+: 0/3/0 \| -: 2/4/8	1	0	0	0	Result
636	SSA_1728	ABC transporter membrane-spanning permease-branched chain amino acid transport, putative	SSA_1729	ABC transporter substrate-binding protein-branched chain amino acid transport, putative	<-<-	1714384	1714628	245	33.9%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
637	SSA_1730	hypothetical protein	SSA_1731	ATP-dependent Clp protease, proteolytic subunit, putative	<-<-	1716148	1716307	160	40%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
638	SSA_1731	ATP-dependent Clp protease, proteolytic subunit, putative	SSA_1732	Uracil phosphoribosyltransferase, putative	<-<-	1716899	1717005	107	26.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
639	SSA_1734	Cation (Mg/Ni uptake) transport ATPase, putative	SSA_1735	UreX, putative	<-<-	1720394	1720550	157	38.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	2	30	142	Result	tttcatacacagggaccaatcactttatgaggacagaacgacacaaatcagcgattggctgtgtatgtgcggttccggataatcgtcaatttgcatcgcatgtctcctttctt
640	SSA_1735	UreX, putative	SSA_1736	L-cysteine desulfhydrase, putative	<-<-	1721163	1721542	380	38.9%	0	0	0	+: 0/1/0 \| -: 1/3/0	1	2	163	297	Result	cgttcaagctttaactccataaggcgatgaaatgagcttagtcttgaccttggcgatcaggactgttgaccaacgagtagtgtctccactgctttgcggtagtcatccgtatccttatggtagcctcacctaccg
642	SSA_1742	Ferrichrome-binding protein, putative	SSA_1743	ABC-type Fe3+-siderophore transport system, permease component, putative	->->	1729948	1730309	362	43.6%	0	0	1	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
644	SSA_1748	Inorganic pyrophosphatase/exopolyphosphatase, putative	SSA_1749	Pyruvate formate-lyase-activating enzyme, putative	<-<-	1734569	1734706	138	31.9%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
645	SSA_1749	Pyruvate formate-lyase-activating enzyme, putative	SSA_1750	Extracellular nuclease, putative	<-<-	1735517	1735762	246	31.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
646	SSA_1750	Extracellular nuclease, putative	SSA_1751	Dextran glucosidase, alpha amylase family, putative	<-<-	1738013	1738199	187	28.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
647	SSA_1752	Phosphotransferase system, trehalose-specific IIBC component, putative	SSA_1753	Transcriptional regulator, GntR family (repressor of trehalose operon), putative	<-->	1741966	1742083	118	28.8%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
648	SSA_1753	Transcriptional regulator, GntR family (repressor of trehalose operon), putative	SSA_1754	hypothetical protein	-><-	1742801	1743214	414	33.8%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
649	SSA_1757	hypothetical protein	SSA_1758	hypothetical protein	<-<-	1745981	1746100	120	23.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
651	SSA_1760	hypothetical protein	SSA_1761	Hemolysin (containing CBS domains), putative	<-<-	1747375	1747526	152	32.9%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
652	SSA_1761	Hemolysin (containing CBS domains), putative	SSA_1762	Permease, putative	<-<-	1748868	1749017	150	33.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
653	SSA_1764	hypothetical protein	SSA_2385	hypothetical protein	->->	1752571	1752681	111	20.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
654	SSA_2385	hypothetical protein	SSA_1765	Conserved uncharacterized protein	->->	1753057	1753175	119	29.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
655	SSA_1765	Conserved uncharacterized protein	SSA_1766	Bacitracin ABC transporter, permease protein, putative	-><-	1753941	1754477	537	36.1%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
656	SSA_1768	Transcriptional regulator, TetR/AcrR family, putative	SSA_1769	hypothetical protein	<-<-	1756790	1757028	239	28%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
657	SSA_1773	hypothetical protein	SSA_1774	RRNA methylase, putative	<-<-	1760183	1760578	396	40.2%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	19	135	277	Result	tcgtcttctcccatccagactatactgtcggttgtggaatctcaccacatcagcttgcgctcgcggacttgatttgacatggagaaaaaaattccaatccaaaaattaccgccggtcgggaatctcaccctgccctgaagaca
658	SSA_1774	RRNA methylase, putative	SSA_1775	Potassium uptake protein, Trk family, putative	<-->	1761134	1761423	290	30.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	2	1	108	Result	tgcccggagtcaagctcagcaaacagcgtggttaaggcttcattaacttacatcacaacaggtttgaggtaaaccaatgaaggtactcatttagtataacactttcag
660	SSA_1787	Diaminopimelate decarboxylase, putative	SSA_1788	Integral membrane protein, possible receptor, putative	<-<-	1771642	1771745	104	38.5%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
661	SSA_1792	Preprotein translocase subunit YidC, putative	SSA_1793	Histidine kinase (sensor protein), putative	-><-	1775100	1775215	116	31.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
662	SSA_1795	Guanosine 3',5'-bis-pyrophosphate (ppGpp) synthetase, putative	SSA_1796	Transcription elongation factor GreA, putative	<-<-	1777762	1777914	153	34%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
663	SSA_1796	Transcription elongation factor GreA, putative	SSA_1797	Aminodeoxychorismate lyase, putative	<-<-	1778398	1778537	140	33.6%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
664	SSA_1800	UDP-N-acetylmuramate--L-alanine ligase, putative	SSA_1801	hypothetical protein	<-<-	1782462	1782741	280	41.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
665	SSA_1802	Snf2 family protein, putative	SSA_1803	GTP-binding protein, putative	<-<-	1786561	1786688	128	29.7%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
666	SSA_1807	hypothetical protein	SSA_1808	hypothetical protein	<-<-	1791314	1791483	170	32.4%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
667	SSA_1809	PTS system glucose-specific EIIC BA component (EIICBA-Glc) (EII- Glc/EIII-Glc), putative	SSA_1810	Two-component response transcriptional regulator (CheY-like receiver and winged-helix DNA-binding domains), putative	<-<-	1794510	1794796	287	31.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
668	SSA_1811	6-phosphogluconate dehydrogenase, putative	SSA_1812	Modification methylase, putative	<-<-	1796921	1797197	277	36.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
669	SSA_1820	hypothetical protein	SSA_1821	Acetyltransferase (N-acetylase of ribosomal proteins), putative	<-<-	1809913	1810136	224	33.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
670	SSA_1821	Acetyltransferase (N-acetylase of ribosomal proteins), putative	SSA_1822	hypothetical protein	<-<-	1810701	1810960	260	43.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	4	7	226	Result	acctcactttccataaaaaagtccctgccatatccatgacagggacgaatcaatatccgcggtaccacccaatttcgggcaggcgcccgcaactctcgtctttgaagtaaatacaaagacacttttatttcatttttaaccatcagcaaccagtcttgacacatttgtggacttctcagcaccgccactttctgtaaaatgcttgactcaaaacacctct
671	SSA_1824	hypothetical protein	SSA_1825	hypothetical protein	<-->	1812837	1813090	254	36.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
672	SSA_1825	hypothetical protein	SSA_1826	Glycerol kinase, putative	->->	1814519	1814675	157	29.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
673	SSA_1828	Glycerol uptake facilitator protein, putative	SSA_1829	RNA methyltransferase, putative	-><-	1818852	1819048	197	34%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
674	SSA_1832	hypothetical protein	SSA_1833	hypothetical protein	->->	1822675	1822801	127	39.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
679	SSA_1837	hypothetical protein	SSA_1839	Cysteine synthase, putative	->->	1833016	1833115	100	23%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
680	SSA_1839	Cysteine synthase, putative	SSA_1840	RNA binding protein, putative	-><-	1834046	1834149	104	28.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
681	SSA_1844	hypothetical protein	SSA_1845	Serine/threonine protein kinase, putative	<-<-	1838274	1838417	144	35.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
683	SSA_1851	Guanylate kinase, putative	SSA_1852	Metal dependent phosphohydrolase (HD motif), putative	<-<-	1846773	1846958	186	32.3%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
684	SSA_1852	Metal dependent phosphohydrolase (HD motif), putative	SSA_1853	S-ribosylhomocysteine lyase, putative	<-->	1848573	1848781	209	27.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
685	SSA_1853	S-ribosylhomocysteine lyase, putative	SSA_1854	Conserved uncharacterized protein	-><-	1849421	1849522	102	32.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
686	SSA_1856	hypothetical protein	SSA_1857	Conserved DivIVA-like protein, putative	<-<-	1852299	1852814	516	44.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	21	102	501	Result	gtcctagcctcagcctatatgcaattttctgtaagccatgttttgttccggaaatgactaggtaccatttccttcgataatcatctgtctactgtttccagtcagagtgctatgttcgcttccacgcactccatgccccgaccaaagtttgggttgctagcttgaggggtttaccgcgttccacttcttctgtttccaaaagaactacgtcactgtggcactttcagacctaatcagacatatccaaagacttagccctttcagtcgccgtaacggaaaaatccgtccctaggcttatttcttcgcctagcacaaacactaccggcatcacagccagtgctagcatggactttcctcatgaaaatctaaaatttccacgcgattatccaaaaattgcact
687	SSA_1864	Nicotinate phosphoribosyltransferase (NAPRTase), subgroup A, putative	SSA_1865	Thioredoxin reductase, putative	<-<-	1860961	1861067	107	31.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
688	SSA_1866	hypothetical protein	SSA_1867	ABC-type polar amino acid transport system, ATPase component, putative	<-<-	1862273	1862442	170	42.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
689	SSA_1868	ABC-type arginine/histidine transport system, permease component, putative	SSA_1869	ATP-dependent RNA helicase, putative	<-<-	1863993	1864241	249	28.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
690	SSA_1869	ATP-dependent RNA helicase, putative	SSA_1870	Phospho-N-acetylmuramoyl-pentapeptide- transferase, putative	<-<-	1865586	1865689	104	39.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
691	SSA_1873	S-adenosyl-methyltransferase mraW, putative	SSA_1874	YorfE protein, putative	<-->	1870235	1870434	200	24%	0	0	0	+: 1/2/0 \| -: 1/0/0	1	0	0	0	Result
692	SSA_1881	hypothetical protein	SSA_1882	Subtilisin-like serine proteases, putative	<-<-	1876055	1876366	312	39.4%	0	0	0	+: 0/1/0 \| -: 1/2/0	1	3	4	144	Result	tctcctttctttcgaacaatagactcagtacgcaaaagaaccacatccgacagtcctaggctattcacctaggggcgtcaagacgcggttccaccctaatttattacttcattacttttgaaattataaccgaaagcgcca
693	SSA_1882	Subtilisin-like serine proteases, putative	SSA_1883	hypothetical protein	<-<-	1880888	1881663	776	35.1%	0	0	0	+: 0/1/0 \| -: 3/1/3	1	0	0	0	Result
694	SSA_1884	Conserved uncharacterized protein	SSA_1888	hypothetical protein	<-<-	1883055	1885179	2125	28%	0	1	0	+: 2/1/0 \| -: 4/0/0	1	0	0	0	Result
695	SSA_1888	hypothetical protein	SSA_1889	Conserved uncharacterized protein	<-<-	1886116	1886372	257	30.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
696	SSA_1889	Conserved uncharacterized protein	SSA_1890	Acetyltransferase, putative	<-<-	1887213	1887782	570	34.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
697	SSA_1892	hypothetical protein	SSA_1893	N-acetylglucosamine-6-phosphate deacetylase, putative	<-<-	1889353	1889510	158	37.3%	0	0	0	+: 0/0/0 \| -: 2/1/1	1	0	0	0	Result
698	SSA_1893	N-acetylglucosamine-6-phosphate deacetylase, putative	SSA_1895	Ribosome-binding factor A, putative	<-<-	1890663	1890904	242	31.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
699	SSA_1895	Ribosome-binding factor A, putative	SSA_1896	Translation initiation factor IF-2, putative	<-<-	1891256	1891431	176	32.4%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
700	SSA_1901	Conserved uncharacterized protein	SSA_1902	tRNA (guanine-N(7)-)-methyltransferase, putative	<-<-	1896690	1896842	153	35.9%	0	0	0	+: 0/2/0 \| -: 1/1/1	1	0	0	0	Result
701	SSA_1907	hypothetical protein	SSA_1909	Transcriptional attenuator LytR, putative	-><-	1900874	1900993	120	40.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
702	SSA_1913	Xanthine/uracil permease family protein, putative	SSA_1914	hypothetical protein	<-<-	1904757	1904901	145	22.8%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
703	SSA_1916	hypothetical protein	SSA_1917	Alcohol dehydrogenase, propanol-preferring, putative	->->	1906440	1906656	217	29.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
704	SSA_1917	Alcohol dehydrogenase, propanol-preferring, putative	SSA_1918	Phosphotransferase system, mannose-specific EIIAB, putative	->->	1907677	1908128	452	29%	0	0	0	+: 1/1/1 \| -: 1/0/0	1	0	0	0	Result
705	SSA_1921	hypothetical protein	SSA_1922	hypothetical protein	-><-	1911378	1911563	186	34.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
706	SSA_1924	Transcriptional regulator, TetR/AcrR family, putative	SSA_1925	Seryl-tRNA synthetase, putative	<-->	1913339	1913647	309	36.2%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
707	SSA_1929	Macrophage infectivity potentiator protein, putative	SSA_1930	Acetyl-CoA carboxylase alpha subunit, putative	<-<-	1917680	1917866	187	28.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
708	SSA_1938	Enoyl-acyl carrier protein(ACP) reductase, putative	SSA_1939	Acyl carrier protein, putative	<-<-	1925829	1925964	136	32.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
709	SSA_1941	hypothetical protein	SSA_1942	Enoyl-CoA hydratase/carnithine racemase, putative	<-<-	1927543	1927794	252	29.8%	0	0	3	+: 0/2/0 \| -: 1/0/0	1	0	0	0	Result
710	SSA_1942	Enoyl-CoA hydratase/carnithine racemase, putative	SSA_1943	Aspartate kinase, putative	<-->	1928587	1928836	250	24%	0	0	0	+: 2/0/0 \| -: 1/1/0	1	0	0	0	Result
715	SSA_1948	Oligopeptide-binding lipoprotein precursor, putative	SSA_1949	AliA protein, putative	<-<-	1942261	1942492	232	34.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
716	SSA_1949	AliA protein, putative	SSA_1950	ABC-type oligopeptide transport system, periplasmic component, putative	<-<-	1944464	1944655	192	34.4%	0	0	0	+: 0/3/0 \| -: 1/1/1	1	0	0	0	Result
717	SSA_1950	ABC-type oligopeptide transport system, periplasmic component, putative	SSA_1951	Penicillin-binding protein 3, putative	<-->	1946618	1946903	286	22.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
718	SSA_1951	Penicillin-binding protein 3, putative	SSA_1952	ABC-type Fe-S cluster assembly transporter, permease component, putative	-><-	1948164	1948301	138	37.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
719	SSA_1958	Adapter protein mecA, putative	SSA_1959	Undecaprenyl-diphosphatase, putative	<-<-	1955504	1955678	175	33.1%	0	0	0	+: 0/0/0 \| -: 1/1/1	1	0	0	0	Result
720	SSA_1959	Undecaprenyl-diphosphatase, putative	SSA_1960	hypothetical protein	<-<-	1956522	1956660	139	38.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
721	SSA_1960	hypothetical protein	SSA_1961	Amino acid ABC transporter, amino acid-binding protein/permease protein, putative	<-->	1958557	1958687	131	31.3%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
722	SSA_1964	conserved uncharacterized protein	SSA_1965	Stomatin/prohibitin-like membrane protease subunits, putative	<-<-	1961302	1961409	108	25.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
723	SSA_1970	Acetolactate synthase, large subunit, biosynthetic type, putative	SSA_1971	hypothetical protein	<-->	1967006	1967306	301	29.2%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
724	SSA_1971	hypothetical protein	SSA_1972	Two-component system transcriptional regulator (CheY domain and HTH-like DNA-binding domain), putative	-><-	1967658	1967900	243	34.2%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
725	SSA_1975	ABC-type multidrug transport system, ATPase component, putative	SSA_1976	Conserved uncharacterized protein	<-<-	1971223	1971639	417	35.5%	0	0	0	+: 0/1/0 \| -: 2/1/1	1	0	0	0	Result
727	SSA_1979	Alkaline-shock protein, putative	SSA_1980	50S ribosomal protein L28, putative	<-<-	1974392	1974533	142	31%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
728	SSA_1980	50S ribosomal protein L28, putative	SSA_1981	hypothetical protein	<-<-	1974723	1974848	126	33.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
729	SSA_1982	Transcriptional regulator, LytR/AlgR family, putative	SSA_1984	Cell surface SD repeat antigen precursor, putative	<-<-	1975964	1976137	174	42%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
730	SSA_1984	Cell surface SD repeat antigen precursor, putative	SSA_1985	hypothetical protein	<-<-	1979126	1979712	587	29%	0	0	0	+: 0/0/0 \| -: 1/3/3	1	0	0	0	Result
732	SSA_1989	ABC-type transport system (uncharacterized), ATPase component, putative	SSA_1990	Zn-porter lipoprotein, putative	<-<-	1985273	1985491	219	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
733	SSA_1991	Pneumococcal histidine triad protein A, putative	SSA_1992	Fructose-bisphosphate aldolase, putative	<-<-	1988863	1989180	318	23.9%	0	0	0	+: 0/2/0 \| -: 1/1/0	1	0	0	0	Result
736	SSA_1994	CTP synthase, putative	SSA_1995	hypothetical protein	<-<-	1992565	1992761	197	38.6%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
737	SSA_1995	hypothetical protein	SSA_1996	DNA-directed RNA polymerase delta subunit, putative	<-<-	1993449	1993568	120	30.8%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
738	SSA_1996	DNA-directed RNA polymerase delta subunit, putative	SSA_1997	Membrane spanning protein, putative	<-<-	1994115	1994251	137	28.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
739	SSA_1997	Membrane spanning protein, putative	SSA_1998	Trigger factor, putative	<-<-	1995002	1995137	136	39%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
740	SSA_2002	tRNA pseudouridine synthase A, putative	SSA_2004	Zinc metalloprotease zmpB precursor, putative	<-<-	1999050	1999305	256	38.3%	0	0	0	+: 0/1/0 \| -: 1/2/1	1	0	0	0	Result
741	SSA_2004	Zinc metalloprotease zmpB precursor, putative	SSA_2005	Chaperone protein dnaJ, putative	<-<-	2005021	2005340	320	29.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
742	SSA_2005	Chaperone protein dnaJ, putative	SSA_2006	4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis enzyme, putative	<-<-	2006475	2006672	198	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	3	152	Result	aagataccaagaccgtaaaattcgactgaaaaataggaaatcaggcgacggagcgatgcccctagacagatttctctcttttccgagaatttaggtcgggttcagttcctttcttttatattgagtcagaatttttggaacccgtgttca
743	SSA_2006	4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis enzyme, putative	SSA_2007	Chaperone protein dnaK/HSP70, putative	<-<-	2007306	2007532	227	40.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
744	SSA_2007	Chaperone protein dnaK/HSP70, putative	SSA_2008	Molecular chaperone GrpE (HSP-70 cofactor), putative	<-<-	2009363	2009615	253	39.5%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	3	30	234	Result	ttttctttttgatactcttcttaggcggcgccgccgtcagagcttgactttatcaatctctttgactaaactttgagcctaaggtctcaaagtttgcgcgaatagcgccactgcgaagagtatcgtctttggctcgcttcgctcactattgcaaagctgaacaattttttatctttcttcatagtttattgtcgtctcggacaag
745	SSA_2009	Heat shock transcription repressor HrcA, putative	SSA_2010	ABC-type multidrug transport system, permease component, putative	<-<-	2011223	2011385	163	38.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	29	163	Result	tcgattagcactcaatcacctcgagtgctaactcatgattctattatacactcttctactccaaagtcaagacaaaaactcaaaaaattagcactctttttacaagagtgctaaaaatcagtctagcgacctaga
746	SSA_2013	hypothetical protein	SSA_2014	D-alanyl-D-alanine carboxypeptidase, putative	<-<-	2013884	2014108	225	30.7%	0	0	0	+: 0/3/0 \| -: 1/3/0	1	0	0	0	Result
747	SSA_2016	Phosphoglycerate mutase, putative	SSA_2017	Hypothetical protein (possibly membrane-associated)	<-<-	2016384	2016524	141	36.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
748	SSA_2017	Hypothetical protein (possibly membrane-associated)	SSA_2018	hypothetical protein	<-<-	2017422	2017553	132	37.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
749	SSA_2019	hypothetical protein	SSA_2020	hypothetical protein	<-->	2019169	2019423	255	31%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
750	SSA_2022	Transcriptional regulator, MerR family (multidrug-efflux transporter genes), putative	SSA_2023	Fructan beta-fructosidase precursor, putative	-><-	2024549	2024698	150	37.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
751	SSA_2023	Fructan beta-fructosidase precursor, putative	SSA_2024	hypothetical protein	<-<-	2028917	2029194	278	32%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
752	SSA_2024	hypothetical protein	SSA_2025	Conserved hypothetical GTPase protein	<-->	2029363	2029935	573	33.3%	0	0	1	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
753	SSA_2025	Conserved hypothetical GTPase protein	SSA_2388	hypothetical protein	-><-	2031073	2031756	684	30.8%	0	0	1	+: 2/0/0 \| -: 0/2/0	1	3	55	209	Result	aaaaaagacatccaagagcaaactcttgaatgtctgtaaagtttgatataatcgtgttgattaacgttttgagaattgtgatgctttacgagctttcttaagacctggtttggaaagtatggatttcagttggactaaaaacagcgtaatatcaa
754	SSA_2026	Cadmium resistance transporter, putative	SSA_2027	P-type ATPase-metal/cation transport (probably copper), putative	<-<-	2032912	2033198	287	32.4%	0	0	0	+: 0/0/0 \| -: 2/1/1	1	0	0	0	Result
757	SSA_2030	hypothetical protein	SSA_2031	Conserved domain uncharacterized protein	<-->	2036841	2037292	452	39.6%	0	9	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
758	SSA_2031	Conserved domain uncharacterized protein	SSA_2032	Integrase/recombinase, phage integrase family, putative	->->	2037902	2038145	244	32.8%	0	0	0	+: 0/2/0 \| -: 1/0/0	1	0	0	0	Result
759	SSA_2032	Integrase/recombinase, phage integrase family, putative	SSA_2033	30S ribosomal protein S9, putative	-><-	2038368	2038476	109	32.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	3	3	109	Result	gggtgaatatggggtgaattttggggtgaactttgattttttgaaacaaaaaagacatccaagaaataattcttgaatgtctgtaaacgttgatataatcgtattga
760	SSA_2034	50S ribosomal protein L13, putative	SSA_2035	Conserved uncharacterized protein	<-<-	2039335	2039514	180	37.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	3	18	119	Result	tcgtttttgtttacagggcggatgttccggtccgcgagttatttgaaaggttccggggccttacaaatggggtaaacaataccgcctactatcatatcaaaa
761	SSA_2037	tRNA (Guanosine-2'-O-)-methyltransferase, TrmH family, putative	SSA_2038	hypothetical protein	<-->	2041615	2041766	152	44.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
762	SSA_2039	Aminoacid specific permease, putative	SSA_2040	ABC transporter ATP-binding protein-multiple sugar transport, putative	<-<-	2044546	2044657	112	36.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
763	SSA_2040	ABC transporter ATP-binding protein-multiple sugar transport, putative	SSA_2041	Leucine-rich protein, putative	<-<-	2045789	2045896	108	30.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
764	SSA_2049	Polyribonucleotide nucleotidyltransferase, putative	SSA_2050	Arabinose efflux permease, putative	<-->	2052985	2053394	410	34.1%	0	0	0	+: 2/1/1 \| -: 2/0/0	1	0	0	0	Result
765	SSA_2050	Arabinose efflux permease, putative	SSA_2051	Oligoendopeptidase, putative	->->	2054757	2054870	114	33.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
766	SSA_2051	Oligoendopeptidase, putative	SSA_2052	Thioredoxin, putative	-><-	2056668	2057282	615	32.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
767	SSA_2055	hypothetical protein	SSA_2056	Cinnamoyl ester hydrolase, putative	<-->	2058251	2058726	476	37.4%	0	0	4	+: 1/0/0 \| -: 2/1/2	1	0	0	0	Result
768	SSA_2056	Cinnamoyl ester hydrolase, putative	SSA_2058	30S ribosomal protein S15, putative	-><-	2059654	2060147	494	39.7%	0	0	0	+: 0/0/0 \| -: 0/6/0	1	5	151	494	Result	aaaaagcactctacaaataagagtgctccattcttgcaggataaaatgtttctagacaaggcgacgagccgaagattgtactaaaattctcttaaaaaataaaaaatctcccctaagggagaagatttggtttattttaccttacagtgctaggaaccgtaaccgaagataatacttgagtatatcgaggtaaggtgacggaacagaaaaagctccctgaagtcagagagccaatttgagctcgggctaaaatcctagtgaaaaagatgaaactccttgtgttcatcgaacacggtgtcgtttccctattttcatacggatttttgacgcccttagcatcatga
769	SSA_2058	30S ribosomal protein S15, putative	SSA_2059	16S rRNA uridine-516 pseudouridylate synthase, putative	<-<-	2060445	2060583	139	40.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
770	SSA_2060	Arabinose efflux permease, putative	SSA_2061	Peptide deformylase, putative	<-->	2062494	2062686	193	39.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
771	SSA_2066	DNA polymerase III polC-type, putative	SSA_2067	hypothetical protein	<-->	2070228	2070393	166	35.5%	0	0	0	+: 0/0/0 \| -: 2/1/0	1	0	0	0	Result
772	SSA_2073	Undecaprenyl pyrophosphate synthetase, putative	SSA_2074	Preprotein translocase subunit YajC, putative	<-<-	2076462	2076689	228	38.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
773	SSA_2074	Preprotein translocase subunit YajC, putative	SSA_2075	Transketolase, putative	<-<-	2077026	2077202	177	36.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
774	SSA_2075	Transketolase, putative	SSA_2076	Conserved uncharacterized protein	<-<-	2079180	2079479	300	31.7%	0	0	0	+: 0/1/0 \| -: 1/2/0	1	0	0	0	Result
775	SSA_2076	Conserved uncharacterized protein	SSA_2077	hypothetical protein	<-<-	2080572	2081441	870	39.2%	1	0	0	+: 2/5/4 \| -: 1/4/0	1	2	719	870	Result	gataaattgagtgtaaaagaatatgaggattcctttagggatagtggtaagtaatgcaaacacctctttgagaggtttgtgacgagtcaagagcaatgaggcttgaacaaagtgaaagccagcgtctttaggcgctggctggtgatgtgggc
776	SSA_2078	hypothetical protein	SSA_2079	Acetyltransferase, putative	<-->	2083928	2084110	183	36.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
778	SSA_2086	hypothetical protein	SSA_2087	Conserved uncharacterized protein	<-<-	2091519	2091763	245	32.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
779	SSA_2087	Conserved uncharacterized protein	SSA_2088	Carbohydrate isomerase, AraD/FucA family, putative	<-<-	2092748	2092855	108	31.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
780	SSA_2091	Phosphotransferase system sugar-specific EII component, putative	SSA_2092	Phosphotransferase system sugar-specific EII component, putative	<-<-	2095653	2095786	134	44.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
781	SSA_2093	PTS system, membrane component, putative	SSA_2094	Conserved uncharacterized protein	<-<-	2097553	2098079	527	42.7%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
782	SSA_2094	Conserved uncharacterized protein	SSA_2096	ATP-dependent protease, ATP-binding subunit, putative	<-<-	2098338	2099646	1309	34.9%	0	0	8	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
783	SSA_2096	ATP-dependent protease, ATP-binding subunit, putative	SSA_2097	Amino acid ABC transporter, ATP-binding protein, putative	<-<-	2101786	2102243	458	26.6%	0	0	0	+: 1/0/0 \| -: 1/2/0	1	0	0	0	Result
784	SSA_2099	ABC-type arginine/histidine transporter, permease protein, putative	SSA_2101	Amino acid ABC transporter, periplasmic amino acid-binding protein, putative	<-<-	2104404	2104598	195	42.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
785	SSA_2105	hypothetical protein	SSA_2106	Flavin monoxygenase, putative	<-<-	2107893	2108104	212	31.1%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
786	SSA_2106	Flavin monoxygenase, putative	SSA_2107	Glucosamine--fructose-6-phosphate aminotransferase [isomerizing], putative	<-<-	2109155	2109384	230	34.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
787	SSA_2107	Glucosamine--fructose-6-phosphate aminotransferase [isomerizing], putative	SSA_2108	Glyceraldehyde 3-phosphate dehydrogenase, putative	<-<-	2111197	2111546	350	31.4%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
788	SSA_2108	Glyceraldehyde 3-phosphate dehydrogenase, putative	SSA_2109	Elongation factor G, putative	<-<-	2112555	2112876	322	31.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
789	SSA_2109	Elongation factor G, putative	SSA_2110	30S ribosomal protein S7, putative	<-<-	2114959	2115198	240	32.9%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
790	SSA_2112	hypothetical protein	SSA_2113	hypothetical protein	<-<-	2116182	2116317	136	36%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
791	SSA_2120	GTPase, putative	SSA_2121	Cell wall surface anchor family protein, putative	<-<-	2121842	2122311	470	38.7%	0	0	69	+: 0/2/0 \| -: 0/3/0	1	0	0	0	Result
793	SSA_2128	hypothetical protein	SSA_2129	Arsenical resistance operon transcription repressor (ArsR), putative	<-<-	2132183	2132312	130	24.6%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
794	SSA_2129	Arsenical resistance operon transcription repressor (ArsR), putative	SSA_2130	hypothetical protein	<-->	2133399	2133603	205	28.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
795	SSA_2132	Ure cluster protein, putative	SSA_2133	3-methyladenine DNA glycosylase, putative	-><-	2135726	2135856	131	31.3%	0	0	0	+: 0/2/0 \| -: 1/1/0	1	0	0	0	Result
796	SSA_2136	50S ribosomal protein L34, putative	SSA_2137	hypothetical protein	<-<-	2137732	2137869	138	33.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
797	SSA_2140	Ribonuclease P protein component, putative	SSA_2141	Argininosuccinate lyase, putative	<-<-	2140665	2140908	244	33.2%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
798	SSA_2142	Argininosuccinate synthase, putative	SSA_2143	Conserved uncharacterized protein	<-<-	2143506	2143679	174	24.7%	0	0	0	+: 0/1/0 \| -: 2/0/0	1	0	0	0	Result
799	SSA_2144	Glutamyl-tRNA synthetase, putative	SSA_2145	Tributyrin esterase, putative	<-<-	2145863	2145968	106	36.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
800	SSA_2146	Metallo-beta-lactamase, putative	SSA_2147	Conserved uncharacterized protein	<-<-	2148490	2149258	769	30.8%	0	0	0	+: 1/3/3 \| -: 2/6/7	1	0	0	0	Result
801	SSA_2150	hypothetical protein	SSA_2151	M protein trans-acting positive transcriptional regulator (MGA), putative	<-->	2151207	2151499	293	21.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
802	SSA_2151	M protein trans-acting positive transcriptional regulator (MGA), putative	SSA_2152	ABC-type transporter (uncharacterized), ATPase component, putative	-><-	2152982	2153132	151	29.1%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
803	SSA_2154	Conserved uncharacterized protein	SSA_2155	hypothetical protein	<-<-	2155350	2155496	147	34%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
804	SSA_2155	hypothetical protein	SSA_2156	Conserved uncharacterized protein	<-<-	2156193	2156305	113	33.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
805	SSA_2156	Conserved uncharacterized protein	SSA_2157	ATP-dependent serine protease, putative	<-<-	2157023	2157137	115	31.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
807	SSA_2164	Glutamine amidotransferase, putative	SSA_2165	ABC-type oligopeptide transporter, periplasmic component, putative	<-->	2161646	2161873	228	28.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
808	SSA_2165	ABC-type oligopeptide transporter, periplasmic component, putative	SSA_2166	ABC-type multidrug transporter, ATPase and permease components, putative	-><-	2163848	2163962	115	33%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
809	SSA_2167	ABC-type multidrug transporter, ATPase and permease components, putative	SSA_2168	Glycerol-3-phosphate dehydrogenase [NAD(P)+], putative	<-->	2167462	2167600	139	26.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
810	SSA_2169	Glucose-1-phosphate uridylyltransferase, putative	SSA_2170	hypothetical protein	-><-	2169546	2169646	101	25.7%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
811	SSA_2174	2,3,4,5-tetrahydropyridine-2-carboxylate N-succinyltransferase, putative	SSA_2175	hypothetical protein	<-<-	2172780	2173235	456	35.1%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
812	SSA_2175	hypothetical protein	SSA_2176	hypothetical protein	<-<-	2174133	2174358	226	34.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
813	SSA_2178	hypothetical protein	SSA_2179	Conserved uncharacterized protein	<-<-	2177686	2178193	508	32.1%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
814	SSA_2182	hypothetical protein	SSA_2183	Glucose-6-phosphate isomerase, putative	<-<-	2181111	2181244	134	29.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
815	SSA_2183	Glucose-6-phosphate isomerase, putative	SSA_2184	hypothetical protein	<-<-	2182628	2183373	746	38.2%	0	0	0	+: 0/2/0 \| -: 1/2/0	1	0	0	0	Result
816	SSA_2184	hypothetical protein	SSA_2185	Adenylosuccinate synthetase, putative	<-<-	2183845	2184087	243	32.9%	0	0	0	+: 0/0/0 \| -: 0/4/0	1	0	0	0	Result
817	SSA_2185	Adenylosuccinate synthetase, putative	SSA_2186	Glutathione biosynthesis bifunctional protein gshAB (Gamma-GCS-GS) (GCS-GS), putative	<-->	2185381	2185674	294	29.9%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
818	SSA_2186	Glutathione biosynthesis bifunctional protein gshAB (Gamma-GCS-GS) (GCS-GS), putative	SSA_2187	Conserved hypothetical membrane associated protein	->->	2187931	2188165	235	30.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
819	SSA_2189	hypothetical protein	SSA_2190	33 kDa chaperonin, putative	<-->	2191188	2191305	118	33.1%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
820	SSA_2192	Conserved uncharacterized protein	SSA_2193	ADP-ribose pyrophosphatase, putative	<-<-	2193933	2194100	168	28%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
822	SSA_2200	Firmicutes transcriptional repressor of class III stress genes (CtsR), putative	SSA_2201	hypothetical protein	<-->	2201664	2201946	283	34.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
825	SSA_2205	Transcription antitermination factor NusG, putative	SSA_2207	hypothetical protein	<-<-	2206191	2206957	767	35.5%	0	0	0	+: 1/3/2 \| -: 0/1/0	2	0	0	0	Result
826	SSA_2206	hypothetical protein	SSA_2208	Preprotein translocase secE component, putative	-><-	2207336	2207823	488	35.2%	0	0	0	+: 1/1/1 \| -: 3/5/4	1	0	0	0	Result
828	SSA_2209	Penicillin-binding protein 2A, putative	SSA_2210	Ribosomal large subunit pseudouridine synthase D, putative	<-->	2210463	2210614	152	32.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
829	SSA_2211	Transmembrane protein, putative	SSA_2212	Possible polysaccharide transport protein, putative	<-<-	2212564	2212716	153	35.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
830	SSA_2212	Possible polysaccharide transport protein, putative	SSA_2213	Nucleotide sugar dehydratase, putative	<-<-	2214019	2214136	118	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
831	SSA_2225	Transcriptional attenuator LytR, putative	SSA_2226	Organic radical activating chaperone, putative	<-<-	2227038	2227240	203	23.2%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
832	SSA_2230	Ribonucleotide reductase, class III, anaerobic, putative	SSA_2231	Heme/copper-type cytochrome/quinol oxidases, subunit 1, putative	<-<-	2231249	2231470	222	30.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
833	SSA_2233	hypothetical protein	SSA_2234	Phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase, phospholipase D family, putative	<-<-	2233201	2233330	130	33.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
834	SSA_2234	Phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase, phospholipase D family, putative	SSA_2235	Conserved uncharacterized protein	<-<-	2234867	2235060	194	34%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
835	SSA_2237	Dihydrofolate:folylpolyglutamate synthetase, putative	SSA_2239	Conserved uncharacterized cytosolic protein	<-<-	2236831	2237011	181	44.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
836	SSA_2241	Conserved uncharacterized protein	SSA_2242	hypothetical protein	<-<-	2238034	2238210	177	33.3%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
837	SSA_2242	hypothetical protein	SSA_2243	Conserved uncharacterized protein	<-<-	2238754	2238858	105	32.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
838	SSA_2243	Conserved uncharacterized protein	SSA_2244	Arsenate reductase, putative	<-<-	2239432	2239566	135	44.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
839	SSA_2246	Competence-damage protein, putative	SSA_2247	hypothetical protein	<-->	2242587	2242784	198	29.3%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
840	SSA_2247	hypothetical protein	SSA_2248	hypothetical protein	-><-	2243196	2243407	212	31.6%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
841	SSA_2250	ABC-type antimicrobial peptide transporter, permease component, putative	SSA_2251	hypothetical protein	<-->	2246502	2247208	707	30.4%	0	0	2	+: 3/0/0 \| -: 0/1/0	1	0	0	0	Result
842	SSA_2251	hypothetical protein	SSA_2252	hypothetical protein	-><-	2248058	2248301	244	32%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
843	SSA_2252	hypothetical protein	SSA_2253	3-Methyladenine DNA glycosylase I, constitutive, putative	<-<-	2248740	2248959	220	34.5%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
844	SSA_2254	Holliday junction DNA helicase ruvA, putative	SSA_2255	Transcriptional regulator, XRE family, putative	<-->	2250115	2250283	169	37.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
845	SSA_2257	DNA mismatch repair protein, putative	SSA_2258	hypothetical protein	<-<-	2253275	2253478	204	37.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
846	SSA_2259	hypothetical protein	SSA_2260	DNA mismatch repair protein hexA, putative	<-<-	2255513	2255690	178	32%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
847	SSA_2261	Transcriptional repressor (arginine synthesis), putative	SSA_2262	Arginyl-tRNA synthetase, putative	<-->	2258757	2259056	300	31%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
848	SSA_2264	hypothetical protein	SSA_2265	Maltodextrin phosphorylase, putative	<-<-	2261848	2262025	178	36%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
849	SSA_2266	4-alpha-glucanotransferase, putative	SSA_2267	Lactose operon transcriptional repressor, LacI family, putative	<-->	2265832	2266266	435	33.8%	0	0	0	+: 2/0/0 \| -: 1/1/1	1	0	0	0	Result
850	SSA_2267	Lactose operon transcriptional repressor, LacI family, putative	SSA_2268	Type II secretory pathway, pullulanase PulA glycosidase, putative	->->	2267251	2267367	117	42.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
851	SSA_2270	Aspartyl-tRNA synthetase, putative	SSA_2271	hypothetical protein	<-<-	2272159	2272327	169	37.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
852	SSA_2271	hypothetical protein	SSA_2272	hypothetical protein	<-<-	2272541	2272666	126	34.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
853	SSA_2282	Phage infection protein, putative	SSA_2283	Conserved uncharacterized protein	<-<-	2285428	2285626	199	32.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
854	SSA_2283	Conserved uncharacterized protein	SSA_2284	Histidyl-tRNA synthetase, putative	<-<-	2285915	2286081	167	26.9%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
855	SSA_2284	Histidyl-tRNA synthetase, putative	SSA_2285	hypothetical protein	<-->	2287363	2287543	181	35.4%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
856	SSA_2286	Dihydroxy-acid dehydratase, putative	SSA_2287	50S ribosomal protein L32, putative	<-->	2289687	2289960	274	28.5%	0	0	0	+: 1/0/0 \| -: 1/1/1	1	0	0	0	Result
857	SSA_2287	50S ribosomal protein L32, putative	SSA_2288	Cadmium resistance transporter, putative	->->	2290144	2290600	457	33.9%	0	1	0	+: 2/4/7 \| -: 0/3/0	1	21	168	457	Result	attcaatacgaatcaatacagaagaaaaacgctgatttcaagcgttttttctttttgccaaatgcgatatattgcactgtatttcaattcaaactctacctttttctctaccttttttagataaatatatcatctggatattgaagttaagccctgctataatttcgatggcagggctttttaatatttggtacactaccttcttatctatattttgatggagctgaagttgacatctacaaagtttaatgttagaatacattcaaaaatatatttgaatgaggtgtttt
858	SSA_2290	hypothetical protein	SSA_2291	hypothetical protein	->->	2293025	2293343	319	31.3%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	2	85	319	Result	gaacattatgccttatactgaatatatcaagaaaaactcttgataaaaattttaatagtccaaattgatggccatcaaaggacagattgaaacaaatatgatgatatgacgataaaggtcatgtcttgcatagaattgtttcgctgtttctttgttgtgccttttagcatactcagcgttcaatatttgctcattttgtttccttctgtccaaggacggaaaggagctcatcatt
859	SSA_2291	hypothetical protein	SSA_2292	DNA segregation ATPase FtsK/SpoIIIE-like protein, putative	->->	2293794	2294312	519	37%	0	0	6	+: 0/0/0 \| -: 1/0/0	1	2	3	107	Result	cctcaaatccagtgtctctgtcactggattttttataaaaaaattaaaaatttaacaaataactttgcgtttggttgtctcattctccttagtaataaggaggtg
860	SSA_2293	hypothetical protein	SSA_2294	hypothetical protein	->->	2296016	2296221	206	38.3%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	3	3	206	Result	ccttggggctgtggcttgcgttaagcaaaagccagacagcccctttttatatttcttatctatcatgacctattggggttactacgacccccaataggtcaataatcaataatcacaaaaaattcaatttttttcaaaaaactttgcatctgacctgccatttctccttagtaatagagcccaaaagaaatgaggtaactgcct
862	SSA_2295	Integrase/recombinase, phage integrase family, putative	SSA_2296	Transcriptional regulator, XRE family, putative	-><-	2298424	2298638	215	27.9%	0	0	0	+: 0/2/0 \| -: 0/3/0	1	12	1	147	Result	ctactctaccattcactctaccttttattaggtagcattctagaaacattgatgtaccaacgtttctaacagctaaaatagaaattatttaactcttacagaagttaaataatttatataacaaaaatcctttgaaatcaacatttc
863	SSA_2297	hypothetical protein	SSA_2298	Serine protease containing a PDZ domain, putative	<-<-	2299463	2299658	196	29.1%	0	0	0	+: 1/0/0 \| -: 1/1/1	1	0	0	0	Result
864	SSA_2300	hypothetical protein	SSA_2301	S-layer protein/ peptidoglycan endo-beta-N-acetylglucosaminidase, putative	<-<-	2302599	2302758	160	42.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
865	SSA_2305	hypothetical protein	SSA_2307	hypothetical protein	<-<-	2308150	2308412	263	27%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
866	SSA_2312	hypothetical protein	SSA_2313	hypothetical protein	<-<-	2315372	2315494	123	33.3%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
867	SSA_2314	hypothetical protein	SSA_2315	Conserved uncharacterized protein	<-<-	2316426	2316576	151	30.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
868	SSA_2315	Conserved uncharacterized protein	SSA_2316	General secretory pathway protein F, putative	<-<-	2317036	2317205	170	40%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
869	SSA_2318	PilB-like pili biogenesis ATPase, putative	SSA_2320	hypothetical protein	<-<-	2321185	2322391	1207	31.7%	0	0	0	+: 1/4/2 \| -: 4/3/2	1	0	0	0	Result
870	SSA_2320	hypothetical protein	SSA_2321	Cation (Co/Zn/Cd) efflux protein, putative	<-<-	2325887	2326139	253	20.9%	0	0	0	+: 1/3/2 \| -: 2/2/4	1	0	0	0	Result
871	SSA_2321	Cation (Co/Zn/Cd) efflux protein, putative	SSA_2322	Transcriptional regulator, TetR/AcrR family, putative	<-->	2327016	2327183	168	37.5%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
872	SSA_2325	3-methyladenine DNA glycosylase, putative	SSA_2327	hypothetical protein	<-->	2330812	2331064	253	27.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
873	SSA_2327	hypothetical protein	SSA_2328	Transcriptional repressor of sugar metabolism, GlpR/DeoR family, putative	->->	2331461	2331622	162	29.6%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
874	SSA_2335	D-Ala-teichoic acid biosynthesis protein, putative	SSA_2336	Transcriptional regulator, PadR family, putative	<-->	2338249	2338506	258	27.1%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
875	SSA_2338	Conserved uncharacterized protein	SSA_2339	Microcin C7 resistance protein, putative	->->	2340453	2340595	143	36.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
876	SSA_2342	SPX domain-like protein, putative	SSA_2343	hypothetical protein	<-<-	2343604	2343792	189	29.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
877	SSA_2343	hypothetical protein	SSA_2344	hypothetical protein	<-->	2346217	2346676	460	34.1%	0	0	1	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
878	SSA_2344	hypothetical protein	SSA_2345	hypothetical protein	->->	2346827	2347058	232	34.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
879	SSA_2345	hypothetical protein	SSA_2346	3-oxoacyl-[acyl-carrier-protein] synthase III, putative	-><-	2347563	2347691	129	34.1%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
880	SSA_2346	3-oxoacyl-[acyl-carrier-protein] synthase III, putative	SSA_2347	Coenzyme F390 synthetase, putative	<-<-	2348637	2348736	100	43%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
881	SSA_2349	DTDP-4-dehydrorhamnose 3,5-epimerase, putative	SSA_2350	30S ribosomal protein S4, putative	<-<-	2351799	2352000	202	34.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
882	SSA_2350	30S ribosomal protein S4, putative	SSA_2351	ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component, putative	<-<-	2352739	2352874	136	38.2%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
883	SSA_2353	ABC-type nitrate/sulfonate/bicarbonate transport system, permease component, putative	SSA_2354	hypothetical protein	<-<-	2355393	2355694	302	40.7%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
884	SSA_2358	hypothetical protein	SSA_2359	Glucose inhibited division protein A, putative	<-<-	2360588	2360702	115	35.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
885	SSA_2359	Glucose inhibited division protein A, putative	SSA_2360	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase, putative	<-<-	2362611	2362747	137	33.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
886	SSA_2360	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase, putative	SSA_2361	L-serine dehydratase beta subunit	<-->	2363870	2364167	298	31.5%	0	0	0	+: 1/0/0 \| -: 2/2/0	1	0	0	0	Result
887	SSA_2363	Phosphoglycolate phosphatase, putative	SSA_2364	Immunodominant staphylococcal antigen A precursor, putative	-><-	2366420	2366531	112	28.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
888	SSA_2364	Immunodominant staphylococcal antigen A precursor, putative	SSA_2365	Cobalt transport protein cbiQ, putative	<-<-	2367123	2367332	210	26.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
889	SSA_2371	Zn-dependent peptidase, putative	SSA_2372	hypothetical protein	<-->	2373772	2373946	175	32%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
890	SSA_2373	DNA replication and repair protein recF, putative	SSA_2374	Inosine-5'-monophosphate dehydrogenase, putative	-><-	2375443	2375623	181	25.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
891	SSA_2374	Inosine-5'-monophosphate dehydrogenase, putative	SSA_2375	Tryptophanyl-tRNA synthetase, putative	<-<-	2377106	2377310	205	25.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
892	SSA_2375	Tryptophanyl-tRNA synthetase, putative	SSA_2376	ABC transporter with duplicated ATPase domains, putative	<-->	2378337	2378883	547	31.8%	0	14	0	+: 2/0/0 \| -: 1/1/0	1	0	0	0	Result
895	SSA_2380	hypothetical protein	SSA_2381	DegP protein, putative	<-->	2386235	2386437	203	27.6%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
Total:										1	10	0/41		822	38