Origin IGS:
ttccttaatggagacgtcgttgaagcgactgcttcttaggctcgattcttcaataaccaagacattattgaaaatagacgttaagtaatcatttactaactgaaaattcaaaaccaaccctccttaagaaaatactttgacaatcaaattttatcagatagaaaagtaatttgcaagcttttttgaaaattaatttgattttcaaatatttttgtaaacaacttgcaaaataagcaaccttgaaccgataca
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
tgtatcggttcaaggttgcttattttgcaagttgtttacaaaaatatttgaaaatcaaattaattttcaaaaaagcttgcaaattacttttctatctgataaaatttgattgtcaaagtattttcttaaggagggttggttttgaattttcagttagtaaatgattacttaacgtctattttcaataatgtcttggttattgaagaatcgagcctaagaagcagtcgcttcaacgacgtctccattaaggaa

Mask Tandem Repeat Region ================================================
ttccttaatggagacgtcgttgaagcgactgcttcttaggctcgattcttcaataaccaagacattattgaaaatagacgttaagtaatcatttactaactgaaaattcaaaaccaaccctccttaagaaaatactttgacaatcaaattttatcagatagaaaagtaatttgcaagcttttttgaaaattaatttgattttcaaatatttttgtaaacaacttgcaaaataagcaaccttgaaccgataca

Find is-nt database================================================
Query_seq: SSA_1941:SSA_1942|SSA_1941:SSA_1942:hypothetical protein:Enoyl-CoA hydratase/carnithine racemase, putative:<-<-:1927543..1927794 252
ttccttaatggagacgtcgttgaagcgactgcttcttaggctcgattcttcaataaccaagacattattgaaaatagacgttaagtaatcatttactaactgaaaattcaaaaccaaccctccttaagaaaatactttgacaatcaaattttatcagatagaaaagtaatttgcaagcttttttgaaaattaatttgattttcaaatatttttgtaaacaacttgcaaaataagcaaccttgaaccgataca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: SSA_1941:SSA_1942|SSA_1941:SSA_1942:hypothetical protein:Enoyl-CoA hydratase/carnithine racemase, putative:<-<-:1927543..1927794 252
ttccttaatggagacgtcgttgaagcgactgcttcttaggctcgattcttcaataaccaagacattattgaaaatagacgttaagtaatcatttactaactgaaaattcaaaaccaaccctccttaagaaaatactttgacaatcaaattttatcagatagaaaagtaatttgcaagcttttttgaaaattaatttgattttcaaatatttttgtaaacaacttgcaaaataagcaaccttgaaccgataca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: SSA_1941:SSA_1942|SSA_1941:SSA_1942:hypothetical protein:Enoyl-CoA hydratase/carnithine racemase, putative:<-<-:1927543..1927794 252
ttccttaatggagacgtcgttgaagcgactgcttcttaggctcgattcttcaataaccaagacattattgaaaatagacgttaagtaatcatttactaactgaaaattcaaaaccaaccctccttaagaaaatactttgacaatcaaattttatcagatagaaaagtaatttgcaagcttttttgaaaattaatttgattttcaaatatttttgtaaacaacttgcaaaataagcaaccttgaaccgataca
Intra-Species Hit: Count: 0

Inter-species Hit: Count: 3	Min: 1	Max: 147	Len: 147
Subject: UniRef90_Q1J581 Cluster: Transcriptional regulator, MarR family; n=11; Streptococcus pyogenes|Rep: Transcriptional regulator, MarR family - Streptococcus pyogenes serotype M4 (strain MGAS10750)
HSP  1	e-value: 9.0E-8	bit: 58.2	Len: 147	Query Start:1	Query End:147	Subject Strand: null	Subject Start: 1	Subject End: 49
 L  I  V  K  V  F  S  *  G  G  L  V  L  N  F  Q  L  V  N  D  Y  L  T  S  I  F  N  N  V  L  V  I  E  E  S  S  L  R  S  S  R  F  N  D  V  S  I  K  E .........................................................................................................
 M  T  V  K  V  L  L  L  G  G  I  C  L  E  Y  D  K  I  N  H  Y  L  V  D  I  F  N  R  I  L  V  I  E  E  M  S  L  K  T  S  Q  F  N  D  V  S  L  K  E .........................................................................................................

Subject: UniRef90_Q97SF5 Cluster: Transcriptional regulator, MarR family; n=3; Streptococcus pneumoniae|Rep: Transcriptional regulator, MarR family - Streptococcus pneumoniae
HSP  1	e-value: 1.0E-7	bit: 57.8	Len: 111	Query Start:1	Query End:111	Subject Strand: null	Subject Start: 1	Subject End: 37
 L  N  F  Q  L  V  N  D  Y  L  T  S  I  F  N  N  V  L  V  I  E  E  S  S  L  R  S  S  R  F  N  D  V  S  I  K  E .............................................................................................................................................
 M  D  Y  Q  R  I  N  E  Y  L  T  S  I  F  N  N  V  L  V  I  E  E  V  N  L  R  G  S  R  F  K  D  I  S  I  K  E .............................................................................................................................................

Subject: UniRef90_Q03M56 Cluster: Transcriptional regulator; n=3; Streptococcus thermophilus|Rep: Transcriptional regulator - Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
HSP  1	e-value: 8.0E-6	bit: 51.6	Len: 111	Query Start:1	Query End:111	Subject Strand: null	Subject Start: 1	Subject End: 37
 L  N  F  Q  L  V  N  D  Y  L  T  S  I  F  N  N  V  L  V  I  E  E  S  S  L  R  S  S  R  F  N  D  V  S  I  K  E .............................................................................................................................................
 M  D  Y  D  K  I  N  G  Y  L  V  D  I  F  N  N  V  V  I  I  E  E  A  S  L  K  N  S  K  F  N  D  I  S  L  K  E .............................................................................................................................................


nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnattttatcagatagaaaagtaatttgcaagcttttttgaaaattaatttgattttcaaatatttttgtaaacaacttgcaaaataagcaaccttgaaccgataca
Predict ORF larger than 30AA ================================================
Protein_Len: 38	Strand: -	Start: 92	End: 205
........................................................................................... K  S  V  S  F  E  F  G  V  R  R  L  F  I  S  Q  C  D  F  K  I  L  Y  F  L  L  K  C  A  K  K  F  I  L  K  I  K  M ...............................................
Protein_Len: 39	Strand: -	Start: 1	End: 117
 E  K  I  S  V  D  N  F  R  S  S  R  L  S  S  E  E  I  V  L  V  N  N  F  I  S  T  L  Y  D  N  V  L  Q  F  N  L  V  M .......................................................................................................................................

nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnattttatcagatagaaaagtaatttgcaagcttttttgaaaattaatttgattttcaaatatttttgtaaacaacttgcaaaataagcaaccttgaaccgataca
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================
PromScan Matrix: RpoD-17	Strand: -	Score: 88	Start: 148	End: 177
...................................................................................................................................................CTTGCAAATTACTTTTCTATCTGATAAAAT...........................................................................

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnattttatcagatagaaaagtaatttgcaagcttttttgaaaattaatttgattttcaaatatttttgtaaacaacttgcaaaataagcaaccttgaaccgataca
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 75	HP_score: -5.5	Tail_Score: -4.83169	Start: 180	End: 208	Full_Region: AGTAATTTGCAAGCT TTTTTGAAAATTA ATT TGATTTTCAAATA TTTTTGTAAACAACT
...................................................................................................................................................................................TTTTTGAAAATTAATTTGATTTTCAAATA............................................
TransTerm Strand: +	Conf: 81	HP_score: -8.1	Tail_Score: -4.03995	Start: 182	End: 206	Full_Region: TAATTTGCAAGCTTT TTTGAAAATTA ATT TGATTTTCAAA TATTTTTGTAAACAA
.....................................................................................................................................................................................TTTGAAAATTAATTTGATTTTCAAA..............................................

Find igs database================================================
Query_seq: SSA_1941:SSA_1942|SSA_1941:SSA_1942:hypothetical protein:Enoyl-CoA hydratase/carnithine racemase, putative:<-<-:1927543..1927794 252
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnattttatcagatagaaaagtaatttgcaagcttttttgaaaattaatttgattttcaaatatttttgtaaacaacttgcaaaataagcaaccttgaaccgataca
Intra-Species Hit: Count: 1	Min: 148	Max: 252	Len: 105
Subject: NC_009009_SSA_1941_SSA_1942|hypothetical protein:Enoyl-CoA hydratase/carnithine racemase, putative|NEGATIVE:NEGATIVE|[1927543,1927794]|252
HSP  1	e-value: 7.0E-53	bit: 208.0	Len: 105	Query Start:148	Query End:252	Subject Strand: POSITIVE	Subject Start: 148	Subject End: 252
...................................................................................................................................................attttatcagatagaaaagtaatttgcaagcttttttgaaaattaatttgattttcaaatatttttgtaaacaacttgcaaaataagcaaccttgaaccgataca
...................................................................................................................................................attttatcagatagaaaagtaatttgcaagcttttttgaaaattaatttgattttcaaatatttttgtaaacaacttgcaaaataagcaaccttgaaccgataca

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AUUUUAUCAGAUAGAAAAGUAAUUUGCAAGCUUUUUUGAAAAUUAAUUUGAUUUUCAAAUAUUUUUGUAAACAACUUGCAAAAUAAGCAACCUUGAACCGAUACA
....((((........((((..((((((((..(.((((((((((.....)))))))))).)..))))))))..))))((.......))...........)))).. (-17.90)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGUAUCGGUUCAAGGUUGCUUAUUUUGCAAGUUGUUUACAAAAAUAUUUGAAAAUCAAAUUAAUUUUCAAAAAAGCUUGCAAAUUACUUUUCUAUCUGAUAAAAU
..((((((...(((((.......(((((((((((....))......(((((((((.......)))))))))...)))))))))..))))).....)))))).... (-20.20)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
204	100	52	120	74	NC_009009:SSA_0967|5end_hypothetical_protein_975872..976102_POSITIVE
198	32	2	139	108	NC_009009:SSA_0195|5end_hypothetical_protein_195113..195343_POSITIVE
191	56	17	217	179	NC_009009:SSA_1980|5end_50S_ribosomal_protein_L28,_putative_1974632..1974862_NEGATIVE
186	99	51	162	114	NC_009009:SSA_1778|5end_Segregation_and_condensation_protein_B,_putative_1765711..1765941_NEGATIVE
186	50	1	68	15	NC_009009:SSA_1404|5end_hypothetical_protein_1418723..1418953_NEGATIVE
184	99	58	89	42	NC_009009:SSA_0283|5end_Phosphotransferase_system_(PTS),_cellobiose-specific_IIB_component,_putative_274559..274789_POSITIVE
182	57	17	90	44	NC_009009:SSA_0367|5end_hypothetical_protein_358309..358539_POSITIVE
179	41	6	220	181	NC_009009:SSA_0091|5end_V-type_sodium_ATPase,_subunit_A,_putative_91037..91267_POSITIVE
177	79	32	64	22	NC_009009:SSA_0913|5end_Acetyltransferase,_putative_924195..924425_POSITIVE
175	40	3	119	87	NC_009009:SSA_1856|5end_hypothetical_protein_1852208..1852438_NEGATIVE
174	39	11	215	188	NC_009009:SSA_0483|5end_Siroheme_synthase,_putative_484045..484275_POSITIVE
173	40	6	191	157	NC_009009:SSA_2367|5end_ABC-type_cobalt_transport_system,_ATPase_component,_putative_2369732..2369962_NEGATIVE
173	37	1	57	14	NC_009009:SSA_0465|5end_Precorrin-8X_methylmutase_/_precorrin_isomerase,_putative_469185..469415_POSITIVE
172	39	6	60	23	NC_009009:SSA_1577|5end_Proline_dipeptidase,_putative_1580294..1580524_POSITIVE
172	68	25	97	56	NC_009009:SSA_0735|5end_Integral_membrane_protein,_putative_717103..717333_POSITIVE
171	29	1	108	76	NC_009009:SSA_0299|5end_hypothetical_protein_292759..292989_POSITIVE
169	68	31	165	120	NC_009009:SSA_0526|5end_hypothetical_protein_523960..524190_POSITIVE
168	88	47	201	148	NC_009009:SSA_1230|5end_Conserved_uncharacterized_protein_1253358..1253588_NEGATIVE
168	59	16	167	121	NC_009009:SSA_1136|5end_ATPases_with_chaperone_activity,_ATP-binding_subunit,_putative_1161924..1162154_POSITIVE
166	62	23	198	158	NC_009009:SSA_0078|5end_N-acetylneuraminate_lyase,_putative_81904..82134_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
196	39	2	53	10	NC_009009:SSA_0706|3end_RNA_helicase,_putative_692909..693059_POSITIVE
191	56	17	90	52	NC_009009:SSA_1981|3end_hypothetical_protein_1974759..1974909_NEGATIVE
184	99	58	68	21	NC_009009:SSA_0282|3end_Phosphotransferase_system_(PTS),_cellobiose-specific_IIA_component,_putative_274618..274768_POSITIVE
183	32	5	134	108	NC_009009:SSA_1166|3end_hypothetical_protein_1192350..1192500_POSITIVE
179	41	6	136	97	NC_009009:SSA_0090|3end_Acetyltransferase,_GNAT_family,_putative_91033..91183_POSITIVE
176	32	1	58	27	NC_009009:SSA_0911|3end_hypothetical_protein_922898..923048_POSITIVE
173	37	1	47	4	NC_009009:SSA_0464|3end_Cobalamin_biosynthesis_protein_cobD,_putative_469255..469405_POSITIVE
172	68	25	110	69	NC_009009:SSA_0734|3end_Arsenical_resistance_operon_transcription_repressor_(ArsR),_putative_717196..717346_POSITIVE
167	42	13	47	15	NC_009009:SSA_0369|3end_NADP-specific_glutamate_dehydrogenase,_putative_359723..359873_NEGATIVE
166	62	23	135	95	NC_009009:SSA_0077|3end_Oxidoreductase,_putative_81921..82071_POSITIVE
164	98	60	67	33	NC_009009:SSA_2178|3end_hypothetical_protein_2176288..2176438_NEGATIVE
162	45	1	99	51	NC_009009:SSA_1157|3end_PvaA-like_protein,_putative_1186218..1186368_POSITIVE
162	40	8	77	45	NC_009009:SSA_0767|3end_Diacylglycerol_kinase_catalytic_domain_protein,_putative_748054..748204_POSITIVE
160	100	52	78	37	NC_009009:SSA_2186|3end_Glutathione_biosynthesis_bifunctional_protein_gshAB_(Gamma-GCS-GS)_(GCS-GS),_putative_2187870..2188020_POSITIVE
159	79	31	130	86	NC_009009:SSA_2240|3end_Holliday_junction_resolvase,_putative_2237258..2237408_NEGATIVE
156	36	1	118	85	NC_009009:SSA_2175|3end_hypothetical_protein_2173146..2173296_NEGATIVE
156	70	24	39	2	NC_009009:SSA_0378|3end_TRZ/ATZ_family_hydrolase,_putative_368627..368777_POSITIVE
155	39	9	128	93	NC_009009:SSA_0643|3end_hypothetical_protein_630072..630222_NEGATIVE
155	100	80	56	35	NC_009009:SSA_0288|3end_hypothetical_protein_280740..280890_NEGATIVE
153	57	17	58	20	NC_009009:SSA_1975|3end_ABC-type_multidrug_transport_system,_ATPase_component,_putative_1970257..1970407_NEGATIVE