Origin IGS: gattgcctccttagaatttaaactgccttcccctttgcacccttatcctaacaaaagggcagcgccaaatctaccctttttcggtaagtggtaagtttctgcaggtaagtggtagaaaaagtagctctataatttctgtagtgggtaaaaccactgtaggaatgagcgaaacgctttcggctttcggaactttgacaattttaaaactagaatcctcatcgctttgaacatcaaaaaggagaggactgatttagtcctctccagattataacttttcatcaacccactacagttgaaaaagagccgcttttcttatagctaataac .........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9 gttattagctataagaaaagcggctctttttcaactgtagtgggttgatgaaaagttataatctggagaggactaaatcagtcctctcctttttgatgttcaaagcgatgaggattctagttttaaaattgtcaaagttccgaaagccgaaagcgtttcgctcattcctacagtggttttacccactacagaaattatagagctactttttctaccacttacctgcagaaacttaccacttaccgaaaaagggtagatttggcgctgcccttttgttaggataagggtgcaaaggggaaggcagtttaaattctaaggaggcaatc Mask Tandem Repeat Region ================================================ gattgcctccttagaatttaaactgccttcccctttgcacccttatcctaacaaaagggcagcgccaaatctaccctttttcggtaagtggtaagtttctgcaggtaagtggtagaaaaagtagctctataatttctgtagtgggtaaaaccactgtaggaatgagcgaaacgctttcggctttcggaactttgacaattttaaaactagaatcctcatcgctttgaacatcaaaaaggagaggactgatttagtcctctccagattataacttttcatcaacccactacagttgaaaaagagccgcttttcttatagctaataac Find is-nt database================================================ Query_seq: SSA_1481:SSA_1482|SSA_1481:SSA_1482:FmtA-like protein, putative:Pullulanase, putative:<-<-:1486713..1487038 326 gattgcctccttagaatttaaactgccttcccctttgcacccttatcctaacaaaagggcagcgccaaatctaccctttttcggtaagtggtaagtttctgcaggtaagtggtagaaaaagtagctctataatttctgtagtgggtaaaaccactgtaggaatgagcgaaacgctttcggctttcggaactttgacaattttaaaactagaatcctcatcgctttgaacatcaaaaaggagaggactgatttagtcctctccagattataacttttcatcaacccactacagttgaaaaagagccgcttttcttatagctaataac Intra-Species Hit: Count: 0 Inter-species Hit: Count: 0 Find is-aa database================================================ Query_seq: SSA_1481:SSA_1482|SSA_1481:SSA_1482:FmtA-like protein, putative:Pullulanase, putative:<-<-:1486713..1487038 326 gattgcctccttagaatttaaactgccttcccctttgcacccttatcctaacaaaagggcagcgccaaatctaccctttttcggtaagtggtaagtttctgcaggtaagtggtagaaaaagtagctctataatttctgtagtgggtaaaaccactgtaggaatgagcgaaacgctttcggctttcggaactttgacaattttaaaactagaatcctcatcgctttgaacatcaaaaaggagaggactgatttagtcctctccagattataacttttcatcaacccactacagttgaaaaagagccgcttttcttatagctaataac Intra-Species Hit: Count: 0 Inter-species Hit: Count: 60 Min: 164 Max: 293 Len: 130 Subject: UniRef90_Q84AQ9 Cluster: Transposase ORF2; n=1; Streptococcus gordonii|Rep: Transposase ORF2 - Streptococcus gordonii HSP 1 e-value: 1.0E-11 bit: 64.7 Len: 105 Query Start:164 Query End:268 Subject Strand: null Subject Start: 236 Subject End: 270 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R L .......................................................... ................................................................................................................................................................... K R N A F G F R N F E N F K T R T L I A L N I K K E R T N L V L S R L .......................................................... Subject: gi|116626987|ref|YP_819606.1| Transposase [Streptococcus thermophilus LMD-9] HSP 1 e-value: 2.0E-10 bit: 61.2 Len: 105 Query Start:164 Query End:268 Subject Strand: null Subject Start: 265 Subject End: 299 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R L .......................................................... ................................................................................................................................................................... K R N A F S F R N F D N F K T R I F I V L N I K E E R T N L V L S R L .......................................................... Subject: UniRef90_Q03N12 Cluster: Transposase; n=1; Streptococcus thermophilus LMD-9|Rep: Transposase - Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9) HSP 1 e-value: 2.0E-10 bit: 61.2 Len: 105 Query Start:164 Query End:268 Subject Strand: null Subject Start: 265 Subject End: 299 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R L .......................................................... ................................................................................................................................................................... K R N A F S F R N F D N F K T R I F I V L N I K E E R T N L V L S R L .......................................................... Subject: gi|81096201|ref|ZP_00874549.1| degenerate transposase (orf2) [Streptococcus suis 89/1591] HSP 1 e-value: 3.0E-10 bit: 60.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 70 Subject End: 103 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L I A L N I K K E R T K F V L S R ............................................................. Subject: gi|81097079|ref|ZP_00875392.1| transposase (orf2) [Streptococcus suis 89/1591] HSP 1 e-value: 3.0E-10 bit: 60.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 173 Subject End: 206 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L I A L N I K K E R T K F V L S R ............................................................. Subject: gi|81177337|ref|ZP_00876174.1| Transposase, IS204/IS1001/IS1096/IS1165 [Streptococcus suis 89/1591] HSP 1 e-value: 3.0E-10 bit: 60.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 191 Subject End: 224 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L I A L N I K K E R T K F V L S R ............................................................. Subject: gi|81177406|ref|ZP_00876229.1| transposase (orf2) [Streptococcus suis 89/1591] HSP 1 e-value: 3.0E-10 bit: 60.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 157 Subject End: 190 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L I A L N I K K E R T K F V L S R ............................................................. Subject: gi|81177441|ref|ZP_00876255.1| Transposase, IS204/IS1001/IS1096/IS1165 [Streptococcus suis 89/1591] HSP 1 e-value: 3.0E-10 bit: 60.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 208 Subject End: 241 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L I A L N I K K E R T K F V L S R ............................................................. Subject: gi|81096210|ref|ZP_00874558.1| Transposase, IS204/IS1001/IS1096/IS1165 [Streptococcus suis 89/1591] HSP 1 e-value: 3.0E-10 bit: 60.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 384 Subject End: 417 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L I A L N I K K E R T K F V L S R ............................................................. Subject: gi|81096710|ref|ZP_00875044.1| Transposase, IS204/IS1001/IS1096/IS1165 [Streptococcus suis 89/1591] HSP 1 e-value: 3.0E-10 bit: 60.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 384 Subject End: 417 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L I A L N I K K E R T K F V L S R ............................................................. Subject: gi|81096880|ref|ZP_00875206.1| Transposase, IS204/IS1001/IS1096/IS1165 [Streptococcus suis 89/1591] HSP 1 e-value: 3.0E-10 bit: 60.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 384 Subject End: 417 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L I A L N I K K E R T K F V L S R ............................................................. Subject: gi|81097317|ref|ZP_00875611.1| Transposase, IS204/IS1001/IS1096/IS1165 [Streptococcus suis 89/1591] HSP 1 e-value: 3.0E-10 bit: 60.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 384 Subject End: 417 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L I A L N I K K E R T K F V L S R ............................................................. Subject: gi|81177137|ref|ZP_00876016.1| Transposase, IS204/IS1001/IS1096/IS1165 [Streptococcus suis 89/1591] HSP 1 e-value: 3.0E-10 bit: 60.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 384 Subject End: 417 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L I A L N I K K E R T K F V L S R ............................................................. Subject: UniRef90_Q2ZXK4 Cluster: Transposase; n=4; Streptococcus|Rep: Transposase - Streptococcus suis 89/1591 HSP 1 e-value: 3.0E-10 bit: 60.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 157 Subject End: 190 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L I A L N I K K E R T K F V L S R ............................................................. Subject: UniRef90_Q2ZY67 Cluster: Transposase, IS204/IS1001/IS1096/IS1165; n=10; Streptococcus|Rep: Transposase, IS204/IS1001/IS1096/IS1165 - Streptococcus suis 89/1591 HSP 1 e-value: 3.0E-10 bit: 60.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 384 Subject End: 417 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L I A L N I K K E R T K F V L S R ............................................................. Subject: gi|116627475|ref|YP_820094.1| Transposase [Streptococcus thermophilus LMD-9] HSP 1 e-value: 6.0E-10 bit: 59.3 Len: 105 Query Start:164 Query End:268 Subject Strand: null Subject Start: 384 Subject End: 418 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R L .......................................................... ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L M A V N I K K E K T K L V L S R I .......................................................... Subject: gi|116627667|ref|YP_820286.1| Transposase [Streptococcus thermophilus LMD-9] HSP 1 e-value: 6.0E-10 bit: 59.3 Len: 105 Query Start:164 Query End:268 Subject Strand: null Subject Start: 384 Subject End: 418 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R L .......................................................... ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L M A V N I K K E K T K L V L S R I .......................................................... Subject: gi|116627930|ref|YP_820549.1| Transposase [Streptococcus thermophilus LMD-9] HSP 1 e-value: 6.0E-10 bit: 59.3 Len: 105 Query Start:164 Query End:268 Subject Strand: null Subject Start: 384 Subject End: 418 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R L .......................................................... ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L M A V N I K K E K T K L V L S R I .......................................................... Subject: gi|116628285|ref|YP_820904.1| Transposase [Streptococcus thermophilus LMD-9] HSP 1 e-value: 6.0E-10 bit: 59.3 Len: 105 Query Start:164 Query End:268 Subject Strand: null Subject Start: 384 Subject End: 418 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R L .......................................................... ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L M A V N I K K E K T K L V L S R I .......................................................... Subject: gi|116628412|ref|YP_821031.1| Transposase [Streptococcus thermophilus LMD-9] HSP 1 e-value: 6.0E-10 bit: 59.3 Len: 105 Query Start:164 Query End:268 Subject Strand: null Subject Start: 408 Subject End: 442 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R L .......................................................... ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L M A V N I K K E K T K L V L S R I .......................................................... Subject: UniRef90_Q03IY7 Cluster: Transposase; n=4; Streptococcus thermophilus|Rep: Transposase - Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9) HSP 1 e-value: 6.0E-10 bit: 59.3 Len: 105 Query Start:164 Query End:268 Subject Strand: null Subject Start: 408 Subject End: 442 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R L .......................................................... ................................................................................................................................................................... K R N A F G F R N F E N F K K R I L M A V N I K K E K T K L V L S R I .......................................................... Subject: gi|55820116|ref|YP_138558.1| IS1167, transposase, ISL3 family, truncated [Streptococcus thermophilus LMG 18311] HSP 1 e-value: 6.0E-10 bit: 53.1 Len: 87 Query Start:164 Query End:250 Subject Strand: null Subject Start: 31 Subject End: 59 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D ............................................................................ ................................................................................................................................................................... K R N A F S F R N F D N F K T R I F I V L N I K K E R T N ............................................................................ HSP 2 e-value: 6.0E-10 bit: 26.2 Len: 39 Query Start:255 Query End:293 Subject Strand: null Subject Start: 61 Subject End: 73 .............................................................................................................................................................................................................................................................. S S P D Y N F S S T H Y S ................................. .............................................................................................................................................................................................................................................................. S S P G C N F S S T H Y S ................................. Subject: UniRef90_UPI000046D9B2 Cluster: IS1167, transposase, ISL3 family, truncated; n=2; Streptococcus thermophilus|Rep: IS1167, transposase, ISL3 family, truncated - Streptococcus thermophilus LMG 18311 HSP 1 e-value: 6.0E-10 bit: 53.1 Len: 87 Query Start:164 Query End:250 Subject Strand: null Subject Start: 31 Subject End: 59 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D ............................................................................ ................................................................................................................................................................... K R N A F S F R N F D N F K T R I F I V L N I K K E R T N ............................................................................ HSP 2 e-value: 6.0E-10 bit: 26.2 Len: 39 Query Start:255 Query End:293 Subject Strand: null Subject Start: 61 Subject End: 73 .............................................................................................................................................................................................................................................................. S S P D Y N F S S T H Y S ................................. .............................................................................................................................................................................................................................................................. S S P G C N F S S T H Y S ................................. Subject: gi|15902085|ref|NP_357635.1| Transposase (orf2) [Streptococcus pneumoniae R6] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 221 Subject End: 254 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: gi|15903030|ref|NP_358580.1| Degenerate transposase (orf2) [Streptococcus pneumoniae R6] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 133 Subject End: 166 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: gi|15903052|ref|NP_358602.1| Degenerate transposase (orf2) [Streptococcus pneumoniae R6] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 138 Subject End: 171 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: gi|15903718|ref|NP_359268.1| Degenerate transposase (orf2) [Streptococcus pneumoniae R6] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 138 Subject End: 171 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: gi|15903744|ref|NP_359294.1| Degenerate transposase (orf2) [Streptococcus pneumoniae R6] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 141 Subject End: 174 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: gi|55820906|ref|YP_139348.1| IS1167, transposase, ISL3 family, truncated [Streptococcus thermophilus LMG 18311] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 65 Subject End: 98 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N T F G F R N F E N F K K R I L I A L N I K K E R T K F V L S R ............................................................. Subject: gi|55822826|ref|YP_141267.1| IS1167, transposase, ISL3 family, truncated [Streptococcus thermophilus CNRZ1066] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 208 Subject End: 241 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N T F G F R N F E N F K K R I L I A L N I K K E R T K F V L S R ............................................................. Subject: gi|15903758|ref|NP_359308.1| Degenerate transposase (fusion of orf1 and orf2) [Streptococcus pneumoniae R6] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 111 Subject End: 144 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: gi|15903763|ref|NP_359313.1| Degenerate transposase (fusion of orf1 and orf2) [Streptococcus pneumoniae R6] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 375 Subject End: 408 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: gi|15901122|ref|NP_345726.1| IS1167, transposase [Streptococcus pneumoniae TIGR4] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 384 Subject End: 417 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: gi|15901294|ref|NP_345898.1| IS1167, transposase [Streptococcus pneumoniae TIGR4] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 384 Subject End: 417 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: gi|15901475|ref|NP_346079.1| IS1167, transposase [Streptococcus pneumoniae TIGR4] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 390 Subject End: 423 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: gi|15901527|ref|NP_346131.1| IS1167, transposase [Streptococcus pneumoniae TIGR4] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 384 Subject End: 417 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: gi|15901621|ref|NP_346225.1| IS1167, transposase [Streptococcus pneumoniae TIGR4] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 384 Subject End: 417 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: gi|116516793|ref|YP_817134.1| IS1167, transposase [Streptococcus pneumoniae D39] HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 375 Subject End: 408 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: UniRef90_Q8CWP1 Cluster: Degenerate transposase; n=2; Streptococcus pneumoniae R6|Rep: Degenerate transposase - Streptococcus pneumoniae (strain ATCC BAA-255 / R6) HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 111 Subject End: 144 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: UniRef90_Q97PH8 Cluster: IS1167, transposase; n=19; Streptococcus pneumoniae|Rep: IS1167, transposase - Streptococcus pneumoniae HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 390 Subject End: 423 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: IS|IS1167.aa1 HSP 1 e-value: 8.0E-10 bit: 58.9 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 391 Subject End: 424 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S R ............................................................. Subject: gi|81176819|ref|ZP_00875803.1| Transposase, IS204/IS1001/IS1096/IS1165 [Streptococcus suis 89/1591] HSP 1 e-value: 1.0E-9 bit: 58.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 196 Subject End: 229 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K H I L I A L N I K K E R T K F V L S R ............................................................. Subject: gi|81096408|ref|ZP_00874753.1| Transposase, IS204/IS1001/IS1096/IS1165 [Streptococcus suis 89/1591] HSP 1 e-value: 1.0E-9 bit: 58.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 384 Subject End: 417 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K H I L I A L N I K K E R T K F V L S R ............................................................. Subject: gi|24379743|ref|NP_721698.1| putative transposase [Streptococcus mutans UA159] HSP 1 e-value: 2.0E-9 bit: 57.8 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 12 Subject End: 45 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R Q A F G F R N F K N F K T K I L I A L N I T K E R T N L I L S R ............................................................. Subject: UniRef90_Q8DTK6 Cluster: Putative transposase; n=1; Streptococcus mutans|Rep: Putative transposase - Streptococcus mutans HSP 1 e-value: 2.0E-9 bit: 57.8 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 12 Subject End: 45 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R Q A F G F R N F K N F K T K I L I A L N I T K E R T N L I L S R ............................................................. Subject: gi|15902809|ref|NP_358359.1| Degenerate transposase (orf2) [Streptococcus pneumoniae R6] HSP 1 e-value: 2.0E-9 bit: 57.4 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 12 Subject End: 45 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T N F V L Y R ............................................................. Subject: gi|15900376|ref|NP_344980.1| IS1167, transposase [Streptococcus pneumoniae TIGR4] HSP 1 e-value: 2.0E-9 bit: 57.4 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 388 Subject End: 421 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S Q ............................................................. Subject: gi|15900723|ref|NP_345327.1| IS1167, transposase [Streptococcus pneumoniae TIGR4] HSP 1 e-value: 2.0E-9 bit: 57.4 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 384 Subject End: 417 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S Q ............................................................. Subject: gi|15901424|ref|NP_346028.1| IS1167, transposase [Streptococcus pneumoniae TIGR4] HSP 1 e-value: 2.0E-9 bit: 57.4 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 384 Subject End: 417 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S Q ............................................................. Subject: UniRef90_Q97SC5 Cluster: IS1167, transposase; n=2; Streptococcus pneumoniae|Rep: IS1167, transposase - Streptococcus pneumoniae HSP 1 e-value: 2.0E-9 bit: 57.4 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 388 Subject End: 421 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S Q ............................................................. Subject: IS|IS1167A.aa1 HSP 1 e-value: 2.0E-9 bit: 57.4 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 384 Subject End: 417 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I A L N I K K E R T K F V L S Q ............................................................. Subject: gi|55822006|ref|YP_140447.1| IS1167, transposase, ISL3 family, truncated [Streptococcus thermophilus CNRZ1066] HSP 1 e-value: 4.0E-9 bit: 50.4 Len: 87 Query Start:164 Query End:250 Subject Strand: null Subject Start: 31 Subject End: 59 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D ............................................................................ ................................................................................................................................................................... K R N A F S F R N F G N F K T R I F I V L N I K K E R T N ............................................................................ HSP 2 e-value: 4.0E-9 bit: 26.2 Len: 39 Query Start:255 Query End:293 Subject Strand: null Subject Start: 61 Subject End: 73 .............................................................................................................................................................................................................................................................. S S P D Y N F S S T H Y S ................................. .............................................................................................................................................................................................................................................................. S S P G C N F S S T H Y S ................................. Subject: gi|71903005|ref|YP_279808.1| transposase [Streptococcus pyogenes MGAS6180] HSP 1 e-value: 7.0E-9 bit: 55.8 Len: 105 Query Start:164 Query End:268 Subject Strand: null Subject Start: 47 Subject End: 81 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R L .......................................................... ................................................................................................................................................................... K R N A F G F R N F D N F K K R I Y L A L N I T K E K T S L V S S R V .......................................................... Subject: IS|ISSg1.aa1 HSP 1 e-value: 9.0E-9 bit: 55.5 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 320 Subject End: 353 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R N A F G F R N F E N F K K R I F I T L N T K K E R T K F V L S R ............................................................. Subject: gi|15902176|ref|NP_357726.1| Degenerate transposase (orf2) [Streptococcus pneumoniae R6] HSP 1 e-value: 1.0E-8 bit: 55.1 Len: 105 Query Start:164 Query End:268 Subject Strand: null Subject Start: 94 Subject End: 128 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R L .......................................................... ................................................................................................................................................................... K R K A F G F R N F N N F K K R I L M T L N I K K E S T N F V L S R L .......................................................... Subject: gi|81097406|ref|ZP_00875692.1| Transposase, IS204/IS1001/IS1096/IS1165 [Streptococcus suis 89/1591] HSP 1 e-value: 1.0E-8 bit: 55.1 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 396 Subject End: 429 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R Q A F G F R N F T N F K T K I Y I A L N I K N E R T N F V L S R ............................................................. Subject: UniRef90_Q8DRH1 Cluster: Degenerate transposase; n=1; Streptococcus pneumoniae R6|Rep: Degenerate transposase - Streptococcus pneumoniae (strain ATCC BAA-255 / R6) HSP 1 e-value: 1.0E-8 bit: 55.1 Len: 105 Query Start:164 Query End:268 Subject Strand: null Subject Start: 94 Subject End: 128 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R L .......................................................... ................................................................................................................................................................... K R K A F G F R N F N N F K K R I L M T L N I K K E S T N F V L S R L .......................................................... Subject: UniRef90_Q2ZZ41 Cluster: Transposase, IS204/IS1001/IS1096/IS1165; n=1; Streptococcus suis 89/1591|Rep: Transposase, IS204/IS1001/IS1096/IS1165 - Streptococcus suis 89/1591 HSP 1 e-value: 1.0E-8 bit: 55.1 Len: 102 Query Start:164 Query End:265 Subject Strand: null Subject Start: 396 Subject End: 429 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R ............................................................. ................................................................................................................................................................... K R Q A F G F R N F T N F K T K I Y I A L N I K N E R T N F V L S R ............................................................. Subject: gi|94989862|ref|YP_597962.1| Transposase [Streptococcus pyogenes MGAS10270] HSP 1 e-value: 3.0E-8 bit: 53.9 Len: 105 Query Start:164 Query End:268 Subject Strand: null Subject Start: 47 Subject End: 81 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R L .......................................................... ................................................................................................................................................................... K R N A F G F R N F D N F K K R I Y L A L N I T K E K A S L V S S R V .......................................................... Subject: UniRef90_Q1JIA5 Cluster: Transposase; n=2; Streptococcus pyogenes|Rep: Transposase - Streptococcus pyogenes serotype M2 (strain MGAS10270) HSP 1 e-value: 3.0E-8 bit: 53.9 Len: 105 Query Start:164 Query End:268 Subject Strand: null Subject Start: 47 Subject End: 81 ................................................................................................................................................................... E R N A F G F R N F D N F K T R I L I A L N I K K E R T D L V L S R L .......................................................... ................................................................................................................................................................... K R N A F G F R N F D N F K K R I Y L A L N I T K E K A S L V S S R V .......................................................... Find nr database================================================ Query_seq: SSA_1481:SSA_1482|SSA_1481:SSA_1482:FmtA-like protein, putative:Pullulanase, putative:<-<-:1486713..1487038 326 gattgcctccttagaatttaaactgccttcccctttgcacccttatcctaacaaaagggcagcgccaaatctaccctttttcggtaagtggtaagtttctgcaggtaagtggtagaaaaagtagctctataatttctgtagtgggtaaaaccactgtaggaatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgaaaaagagccgcttttcttatagctaataac Intra-Species Hit: Count: 0 Inter-species Hit: Count: 0 gattgcctccttagaatttaaactgccttcccctttgcacccttatcctaacaaaagggcagcgccaaatctaccctttttcggtaagtggtaagtttctgcaggtaagtggtagaaaaagtagctctataatttctgtagtgggtaaaaccactgtaggaatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgaaaaagagccgcttttcttatagctaataac Predict ORF larger than 30AA ================================================ Protein_Len: 30 Strand: + Start: 2 End: 91 . M A S L E F K L P S P L H P Y P N K R A A P N L P F F G K W ........................................................................................................................................................................................................................................... Protein_Len: 60 Strand: + Start: 45 End: 224 ............................................ M L T K G Q R Q I Y P F S V S G K F L Q V S G R K S S S I I S V V G K T T V G M S E T L S A F G T L T I L K L E S S S L ...................................................................................................... Protein_Len: 51 Strand: - Start: 130 End: 282 ................................................................................................................................. L K Q L P Y F W Q L F S R F A K P K R F K S L K L V L I R M A K F M L F S L V S K T R E L N Y S K M M ............................................ Protein_Len: 59 Strand: - Start: 74 End: 250 ......................................................................... G K E T L P L N R C T L P L F L L E I I E T T P L V V T P I L S V S E A K P V K V I K F S S D E D S Q V D F L L P S M ............................................................................ gattgcctccttagaatttaaactgccttcccctttgcacccttatcctaacaaaagggcagcgccaaatctaccctttttcggtaagtggtaagtttctgcaggtaagtggtagaaaaagtagctctataatttctgtagtgggtaaaaccactgtaggaatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgaaaaagagccgcttttcttatagctaataac Predict Promoter with matrix: RpoD-15 score > 80================================================ Predict Promoter with matrix: RpoD-16 score > 80================================================ Predict Promoter with matrix: RpoD-17 score > 80================================================ Predict Promoter with matrix: RpoD-18 score > 80================================================ Predict Promoter with matrix: RpoD-19 score > 80================================================ Predict Promoter with matrix: RpoN score > 80================================================ gattgcctccttagaatttaaactgccttcccctttgcacccttatcctaacaaaagggcagcgccaaatctaccctttttcggtaagtggtaagtttctgcaggtaagtggtagaaaaagtagctctataatttctgtagtgggtaaaaccactgtaggaatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgaaaaagagccgcttttcttatagctaataac Predict TransTerm conf > 70================================================ TransTerm Strand: - Conf: 100 HP_score: -14.4 Tail_Score: -4.87626 Start: 238 End: 262 Full_Region: gaaaagttataatct ggagaggact aaatc agtcctctcc tttttgatgttcaaa .............................................................................................................................................................................................................................................ggagaggactaaatcagtcctctcc................................................................ Find igs database================================================ Query_seq: SSA_1481:SSA_1482|SSA_1481:SSA_1482:FmtA-like protein, putative:Pullulanase, putative:<-<-:1486713..1487038 326 gattgcctccttagaatttaaactgccttcccctttgcacccttatcctaacaaaagggcagcgccaaatctaccctttttcggtaagtggtaagtttctgcaggtaagtggtagaaaaagtagctctataatttctgtagtgggtaaaaccactgtaggaatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgaaaaagagccgcttttcttatagctaataac Intra-Species Hit: Count: 1 Min: 1 Max: 326 Len: 326 Subject: NC_009009_SSA_1481_SSA_1482|FmtA-like protein, putative:Pullulanase, putative|NEGATIVE:NEGATIVE|[1486713,1487038]|326 HSP 1 e-value: 2.0E-87 bit: 323.0 Len: 163 Query Start:1 Query End:163 Subject Strand: POSITIVE Subject Start: 1 Subject End: 163 gattgcctccttagaatttaaactgccttcccctttgcacccttatcctaacaaaagggcagcgccaaatctaccctttttcggtaagtggtaagtttctgcaggtaagtggtagaaaaagtagctctataatttctgtagtgggtaaaaccactgtaggaat................................................................................................................................................................... gattgcctccttagaatttaaactgccttcccctttgcacccttatcctaacaaaagggcagcgccaaatctaccctttttcggtaagtggtaagtttctgcaggtaagtggtagaaaaagtagctctataatttctgtagtgggtaaaaccactgtaggaat................................................................................................................................................................... HSP 2 e-value: 8.0E-10 bit: 65.9 Len: 33 Query Start:294 Query End:326 Subject Strand: POSITIVE Subject Start: 294 Subject End: 326 .....................................................................................................................................................................................................................................................................................................tgaaaaagagccgcttttcttatagctaataac .....................................................................................................................................................................................................................................................................................................tgaaaaagagccgcttttcttatagctaataac Inter-species Hit: Count: 0 Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================ GAUUGCCUCCUUAGAAUUUAAACUGCCUUCCCCUUUGCACCCUUAUCCUAACAAAAGGGCAGCGCCAAAUCUACCCUUUUUCGGUAAGUGGUAAGUUUCUGCAGGUAAGUGGUAGAAAAAGUAGCUCUAUAAUUUCUGUAGUGGGUAAAACCACUGUAGGAAUGAGCGAAACGCUUUCGGCUUUCGGAACUUUGACAAUUUUAAAACUAGAAUCCUCAUCGCUUUGAACAUCAAAAAGGAGAGGACUGAUUUAGUCCUCUCCAGAUUAUAACUUUUCAUCAACCCACUACAGUUGAAAAAGAGCCGCUUUUCUUAUAGCUAAUAAC ..........((((........(((((((..(((..(((..((((((((.(((((((((.((........)).)))))))...)).)).))))))....))))))..)).))))).(((((..(((((.......(((((((((((............(....((((((.....(((((.....)))))...(((..((((((....))))))..)))))))))....)........(((((((((((...)))))))))))...................))))))))))).......)))))..))))).......)))).... (-90.34) Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================ GUUAUUAGCUAUAAGAAAAGCGGCUCUUUUUCAACUGUAGUGGGUUGAUGAAAAGUUAUAAUCUGGAGAGGACUAAAUCAGUCCUCUCCUUUUUGAUGUUCAAAGCGAUGAGGAUUCUAGUUUUAAAAUUGUCAAAGUUCCGAAAGCCGAAAGCGUUUCGCUCAUUCCUACAGUGGUUUUACCCACUACAGAAAUUAUAGAGCUACUUUUUCUACCACUUACCUGCAGAAACUUACCACUUACCGAAAAAGGGUAGAUUUGGCGCUGCCCUUUUGUUAGGAUAAGGGUGCAAAGGGGAAGGCAGUUUAAAUUCUAAGGAGGCAAUC .......(((.((..(((((..(((((.......(((((((((((...((((..((((.((...((((((((((.....)))))))))).)).)))).))))((((.((.((((.....(((((..((((.....))))...)))))....((((...))))...))))...)).)))).))))))))))).......)))))..)))))..))........((((.....((((((.((((((..((((((((((........))))))))))....)).))))))))....)).....))))...............))).... (-97.04) Find mRNA Target Using Conserved IGS================================================ 5'END mRNA Target Prediction=================================== Score srna_start srna_end target_start tegart_end seq_id 994 70 21 161 112 NC_009009:SSA_1481|5end_FmtA-like_protein,_putative_1486622..1486852_NEGATIVE 494 80 32 164 117 NC_009009:SSA_0728|5end_Protease,_putative_713688..713918_POSITIVE 414 170 124 182 130 NC_009009:SSA_1477|5end_Truncated_transposase,_putative_1482496..1482726_POSITIVE 411 167 124 176 129 NC_009009:SSA_0732|5end_Transposase,_putative_715896..716126_NEGATIVE 368 63 24 229 189 NC_009009:SSA_2203|5end_30S_ribosomal_protein_S2,_putative_2204205..2204435_NEGATIVE 356 78 31 198 145 NC_009009:SSA_1453|5end_hypothetical_protein_1460208..1460438_NEGATIVE 336 50 1 215 162 NC_009009:SSA_0826|5end_hypothetical_protein_805098..805328_POSITIVE 335 69 23 220 165 NC_009009:SSA_0911|5end_hypothetical_protein_922078..922308_POSITIVE 322 260 213 153 98 NC_009009:SSA_0692|5end_D-Ala-D-Ala_adding_enzyme,_putative_676370..676600_POSITIVE 317 113 80 189 156 NC_009009:SSA_1982|5end_Transcriptional_regulator,_LytR/AlgR_family,_putative_1975873..1976103_NEGATIVE 313 110 63 209 157 NC_009009:SSA_1259|5end_Purine_nucleoside_phosphorylase,_putative_1285722..1285952_NEGATIVE 311 77 32 87 44 NC_009009:SSA_0554|5end_hypothetical_protein_549265..549495_POSITIVE 309 188 141 131 74 NC_009009:SSA_1743|5end_ABC-type_Fe3+-siderophore_transport_system,_permease_component,_putative_1730170..1730400_POSITIVE 298 198 151 170 130 NC_009009:SSA_0512|5end_Nicotinate-nucleotide--dimethylbenzimidazole_phosphoribosyltransferase,_putative_510439..510669_POSITIVE 296 90 41 76 7 NC_009009:SSA_1800|5end_UDP-N-acetylmuramate--L-alanine_ligase,_putative_1782371..1782601_NEGATIVE 296 259 212 155 100 NC_009009:SSA_1650|5end_3-Ketoacyl-ACP_reductase,_putative_1649594..1649824_NEGATIVE 295 193 153 227 189 NC_009009:SSA_2194|5end_Nicotinamide_mononucleotide_transporter,_putative_2195663..2195893_NEGATIVE 293 180 137 115 79 NC_009009:SSA_2162|5end_hypothetical_protein_2160592..2160822_POSITIVE 293 187 141 217 163 NC_009009:SSA_1138|5end_Pyruvate_dehydrogenase,_TPP-dependent_E1_component_alpha-subunit,_putative_1165731..1165961_POSITIVE 292 67 25 54 11 NC_009009:SSA_1459|5end_RNA_methyltransferase,_putative_1467481..1467711_NEGATIVE 3'END mRNA Target Prediction=================================== Score srna_start srna_end target_start tegart_end seq_id 544 315 273 43 1 NC_009009:SSA_2027|3end_P-type_ATPase-metal/cation_transport_(probably_copper),_putative_2033109..2033259_NEGATIVE 490 303 268 36 1 NC_009009:SSA_0731|3end_Integral_membrane_protein,_putative_715654..715804_POSITIVE 414 170 124 54 2 NC_009009:SSA_1476|3end_Phosphoglycerol_transferase,_alkaline_phosphatase_superfamily,_putative_1482448..1482598_POSITIVE 396 120 73 76 25 NC_009009:SSA_0727|3end_Metal-dependent_membrane_protease,_putative_713639..713789_POSITIVE 373 262 238 124 100 NC_009009:SSA_1479|3end_Transposase,_putative_1483889..1484039_POSITIVE 356 78 31 151 98 NC_009009:SSA_1454|3end_hypothetical_protein_1460255..1460405_NEGATIVE 343 305 282 24 1 NC_009009:SSA_1480|3end_hypothetical_protein_1483960..1484110_NEGATIVE 336 50 1 93 40 NC_009009:SSA_0825|3end_DNA-directed_RNA_polymerase,_sigma_subunit_(sigma70/sigma32),_putative_805056..805206_POSITIVE 322 260 213 77 22 NC_009009:SSA_0691|3end_D-ala,D-ala_ligase,_putative_676374..676524_POSITIVE 311 77 32 83 40 NC_009009:SSA_0553|3end_hypothetical_protein_549341..549491_POSITIVE 306 270 222 80 35 NC_009009:SSA_0886|3end_Enolase,_putative_881057..881207_POSITIVE 297 178 140 60 23 NC_009009:SSA_2168|3end_Glycerol-3-phosphate_dehydrogenase_[NAD(P)+],_putative_2168563..2168713_POSITIVE 295 262 238 124 100 NC_009009:SSA_0732|3end_Transposase,_putative_715711..715861_NEGATIVE 290 265 229 85 49 NC_009009:SSA_2156|3end_Conserved_uncharacterized_protein_2156216..2156366_NEGATIVE 287 254 212 138 87 NC_009009:SSA_0967|3end_hypothetical_protein_976620..976770_POSITIVE 283 260 215 83 39 NC_009009:SSA_0394|3end_hypothetical_protein_390931..391081_POSITIVE 278 78 33 123 82 NC_009009:SSA_2098|3end_ABC-type_arginine/histidine_transporter,_permease_protein,_putative_2102931..2103081_NEGATIVE 278 192 151 146 111 NC_009009:SSA_0209|3end_Glutamyl_aminopeptidase,_putative_206572..206722_NEGATIVE 271 64 25 143 107 NC_009009:SSA_1743|3end_ABC-type_Fe3+-siderophore_transport_system,_permease_component,_putative_1731005..1731155_POSITIVE 271 187 141 151 106 NC_009009:SSA_0431|3end_hypothetical_protein_432676..432826_NEGATIVE