CDS GC%: 37.2% tRNA GC%: 56.7% rRNA GC%: 52.1%

IGS#	Up stream Locus	Up stream Product	Down Stream Locus	Down Stream Product	Gene Dir type	Start	End	IGS Len	GC%	IS NT	IS AA	NR	PT-Pair	Intra Spp. IGS	Inter Spp. IGS	Conserved Inter-spp IGS Start	Conserved Inter-spp IGS End	Blast Result	Conserved IGS Seq
1	TDE2786	DNA polymerase III subunit alpha	TDE0001	chromosomal replication initiator protein DnaA	<-<-	1	2843201	604	29.8%	0	0	0	+: 2/0/0 \| -: 2/2/3	1	0	0	0	Result
2	TDE0001	chromosomal replication initiator protein DnaA	TDE0002	DNA gyrase, B subunit	<-->	1576	1683	108	25%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
3	TDE0006	Snf2 family protein	TDE0007	hypothetical protein	<-->	9785	10013	229	28.4%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
4	TDE0007	hypothetical protein	TDE0008	copper-translocating P-type ATPase	->->	10869	11030	162	35.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
5	TDE0008	copper-translocating P-type ATPase	TDE0009	hypothetical protein	-><-	13707	13813	107	34.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
6	TDE0010	MutT/nudix family protein	TDE0011	alkyl hydroperoxide reductase/peroxiredoxin	->->	15287	15547	261	26.1%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
7	TDE0011	alkyl hydroperoxide reductase/peroxiredoxin	TDE0012	carbon starvation protein CstA, putative	->->	16196	16307	112	29.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
8	TDE0013	methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	TDE0014	hypothetical protein	<-->	18730	18929	200	24%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
9	TDE0017	hypothetical protein	TDE0018	LysM domain protein	<-<-	23027	23162	136	38.2%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
10	TDE0019	formate--tetrahydrofolate ligase	TDE0020	glycyl-tRNA synthetase	<-->	25420	25585	166	24.7%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
12	TDE0029	ABC transporter, ATP-binding protein, HlyB family	TDE0030	prolipoprotein diacylglyceryl transferase, putative	<-<-	37813	38017	205	27.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
13	TDE0030	prolipoprotein diacylglyceryl transferase, putative	TDE0031	hypothetical protein	<-<-	38798	38924	127	22.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
14	TDE0031	hypothetical protein	TDE0032	histidine kinase-related ATPase, putative	<-<-	39186	39320	135	20.7%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
15	TDE0034	hypothetical protein	TDE0035	acetyltransferase, GNAT family	<-<-	41541	41669	129	39.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
16	TDE0035	acetyltransferase, GNAT family	TDE0036	hypothetical protein	<-<-	42111	42224	114	28.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
17	TDE0037	transcriptional regulator, AbrB family	TDE0038	3-oxoacyl-(acyl-carrier-protein) synthase II	<-<-	42890	43125	236	25.8%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
20	TDE0040	AMP-binding protein	TDE0041	birA bifunctional protein	<-->	47519	47636	118	27.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
21	TDE0041	birA bifunctional protein	TDE0042	phosphate acetyltransferase	->->	48696	48815	120	24.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
22	TDE0044	ABC transporter, ATP-binding protein	TDE0045	ABC transporter, ATP-binding protein	<-<-	53223	53358	136	20.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
23	TDE0048	hypothetical protein	TDE0049	hypothetical protein	<-<-	57913	58288	376	44.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
24	TDE0049	hypothetical protein	TDE0050	RNA methyltransferase, TrmH family	<-<-	59180	59372	193	23.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
25	TDE0051	alcohol dehydrogenase, iron-containing	TDE0052	flagellar biosynthetic protein FliQ	<-->	61315	61444	130	29.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
26	TDE0061	fic family protein	TDE0062	PTS system, IIA component	<-->	69035	69229	195	27.7%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
27	TDE0062	PTS system, IIA component	TDE0063	hypothetical protein	->->	69722	69853	132	35.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
29	TDE0067	cyclic nucleotide-binding protein	TDE0068	succinyl-diaminopimelate desuccinylase	<-->	75279	75436	158	27.2%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
30	TDE0069	conserved hypothetical protein TIGR00238	TDE0070	RNA polymerase sigma-70 factor, region 2 family	->->	77708	77852	145	22.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
31	TDE0080	betaine aldehyde dehydrogenase	TDE0081	hypothetical protein	<-<-	92303	92642	340	20.9%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
32	TDE0084	phosphoenolpyruvate-protein phosphotransferase	TDE0085	ATP-dependent DNA helicase, UvrD/Rep family	<-<-	97546	97685	140	36.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
33	TDE0086	hypothetical protein	TDE0087	Trk system potassium uptake protein TrkA	<-->	103967	104078	112	19.6%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
34	TDE0095	hypothetical protein	TDE0096	NADH oxidase	->->	112683	112862	180	31.7%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
35	TDE0096	NADH oxidase	TDE0097	hypothetical protein	->->	114198	114336	139	18%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
37	TDE0107	alpha-amylase family protein	TDE0108	hypothetical protein	<-->	128357	128538	182	25.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
38	TDE0109	phenylalanyl-tRNA synthetase alpha subunit	TDE0110	M23/M37 peptidase domain protein	<-->	130471	130720	250	24.4%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
39	TDE0114	iron-dependent transcriptional regulator	TDE0115	hypothetical protein	<-->	134091	134193	103	27.2%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
40	TDE0119	flagellar protein FliS	TDE0120	hypothetical protein	<-->	137589	137787	199	26.1%	0	0	0	+: 1/3/3 \| -: 0/1/0	1	0	0	0	Result
41	TDE0126	hypothetical protein	TDE0127	DNA-binding protein	<-->	145728	145889	162	24.7%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
42	TDE0127	DNA-binding protein	TDE0128	HAMP domain/GGDEF domain/EAL domain protein	->->	146205	146379	175	25.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
43	TDE0129	PyrBI protein	TDE0130	sodium/dicarboxylate symporter family protein	<-->	150390	150684	295	30.8%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
44	TDE0132	hypothetical protein	TDE0133	transcriptional regulator, GntR family	->->	152357	152512	156	36.5%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
45	TDE0133	transcriptional regulator, GntR family	TDE0134	oxidoreductase, FAD-dependent	->->	153263	153543	281	40.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
47	TDE0146	amidohydrolase family protein	TDE0147	hypothetical protein	<-<-	168728	168878	151	24.5%	0	0	0	+: 2/0/0 \| -: 2/0/0	1	0	0	0	Result
48	TDE0155	adenylate/guanylate cyclase catalytic domain protein	TDE0156	adenylate/guanylate cyclase catalytic domain protein	<-<-	180245	180433	189	33.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
49	TDE0156	adenylate/guanylate cyclase catalytic domain protein	TDE0157	KHG/KDPG family aldolase/carbohydrate kinase, PfkB family	<-->	183662	183998	337	26.1%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
50	TDE0158	hypothetical protein	TDE0160	hypothetical protein	<-<-	186039	187234	1196	30.4%	0	0	14	+: 0/1/0 \| -: 4/1/0	1	0	0	0	Result
51	TDE0161	hypothetical protein	TDE0162	hypothetical protein	<-->	187920	188037	118	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
52	TDE0164	hypothetical protein	TDE0165	hypothetical protein	<-->	194089	194261	173	19.7%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
54	TDE0178	methyl-accepting chemotaxis protein	TDE0179	hypothetical protein	<-<-	212719	212860	142	43%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
55	TDE0183	ABC transporter, permease protein	TDE0184	ABC transporter, ATP-binding protein	<-->	218682	218887	206	27.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
56	TDE0186	hypothetical protein	TDE0187	carboxylesterase, putative	<-->	223789	223984	196	23%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
57	TDE0187	carboxylesterase, putative	TDE0188	adenosine deaminase	->->	224753	224860	108	22.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
58	TDE0193	hypothetical protein	TDE0194	hypothetical protein	<-<-	230680	230828	149	38.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
59	TDE0195	acetyltransferase, GNAT family	TDE0196	hypothetical protein	<-->	232602	232710	109	28.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
60	TDE0201	hypothetical protein	TDE0202	hypothetical protein	-><-	235785	235959	175	39.4%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
61	TDE0206	surface antigen, putative	TDE0207	permease, GntP family	<-->	241618	241741	124	24.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
62	TDE0210	cob(I)yrinic acid a,c-diamide adenosyltransferase	TDE0211	ABC transporter, permease protein, cysTW family	-><-	246207	246644	438	45.9%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
65	TDE0226	hypothetical protein	TDE0227	adenine-specific DNA modification methyltransferase	<-->	256784	257075	292	16.8%	0	0	0	+: 3/0/0 \| -: 1/1/0	1	0	0	0	Result
66	TDE0228	hypothetical protein	TDE0229	ATPase family protein	<-<-	260694	260955	262	19.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
67	TDE0231	DNA polymerase III, beta subunit	TDE0232	appr-1-p processing enzyme domain protein	<-->	265084	265353	270	20.4%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
68	TDE0233	fic family protein	TDE0234	ABC transporter, ATP-binding protein, HlyB family	<-->	267011	267192	182	22%	0	0	0	+: 0/0/0 \| -: 1/3/0	1	0	0	0	Result
69	TDE0237	HDIG domain protein	TDE0238	thioredoxin, selenocysteine-containing	<-->	271281	271519	239	30.1%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
70	TDE0240	glycine reductase complex protein GrdC	TDE0241	hypothetical protein	<-<-	274624	274790	167	23.4%	0	0	0	+: 1/0/0 \| -: 3/0/0	1	0	0	0	Result
71	TDE0245	ABC transporter, ATP-binding/permease protein	TDE0246	transcriptional regulator, TetR family	<-<-	281034	281185	152	28.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
72	TDE0246	transcriptional regulator, TetR family	TDE0248	hypothetical protein	<-->	281756	282207	452	37.4%	0	0	189	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
73	TDE0248	hypothetical protein	TDE0249	flavoredoxin, putative	->->	282577	282678	102	28.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
74	TDE0249	flavoredoxin, putative	TDE0250	sodium-dependent transporter, putative	-><-	283243	283399	157	33.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
75	TDE0251	tryptophanase	TDE0252	hypothetical protein	<-->	286187	286402	216	28.2%	0	0	0	+: 1/1/0 \| -: 1/0/0	1	0	0	0	Result
76	TDE0258	methlytransferase, UbiE/COQ5 family	TDE0259	transcriptional regulator, MarR family	<-->	292975	293396	422	30.6%	0	0	0	+: 2/2/0 \| -: 2/2/2	1	0	0	0	Result
77	TDE0264	ribbon-helix-helix protein, CopG family	TDE0266	hypothetical protein	<-<-	297378	297856	479	29.6%	0	0	8	+: 1/0/0 \| -: 2/1/2	1	0	0	0	Result
78	TDE0267	HAM1 protein	TDE0268	hypothetical protein	<-<-	299199	299308	110	44.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
79	TDE0268	hypothetical protein	TDE0269	hypothetical protein	<-<-	300140	300285	146	42.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
80	TDE0269	hypothetical protein	TDE0270	hypothetical protein	<-<-	300778	300934	157	26.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
82	TDE0274	ABC transporter, ATP-binding/permease protein	TDE0275	CAAX amino terminal protease family protein	<-->	306514	306772	259	24.7%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
83	TDE0279	hypothetical protein	TDE0280	PIN domain protein	<-<-	309873	309984	112	44.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
84	TDE0281	hypothetical protein	TDE0282	ABC transporter, ATP-binding protein	<-<-	310581	310744	164	34.1%	0	0	0	+: 0/2/0 \| -: 2/4/0	1	0	0	0	Result
85	TDE0284	hypothetical protein	TDE0285	translation elongation factor G	<-->	313519	313761	243	27.2%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
86	TDE0291	hypothetical protein	TDE0292	hypothetical protein	<-<-	321151	321264	114	28.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
87	TDE0295	DNA gyrase, A subunit	TDE0296	formiminotransferase, putative	<-<-	326758	326931	174	35.1%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
88	TDE0298	hypothetical protein	TDE0299	mutator mutT protein	->->	330062	330219	158	24.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
89	TDE0299	mutator mutT protein	TDE0300	leucyl aminopeptidase	->->	330640	330982	343	26.8%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
90	TDE0303	hypothetical protein	TDE0304	hypothetical protein	->->	333920	334022	103	27.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
91	TDE0304	hypothetical protein	TDE0305	GTP-binding protein YchF	-><-	335553	335734	182	29.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
93	TDE0316	ABC transporter, ATP-binding/permease protein	TDE0317	hypothetical protein	<-->	350550	350795	246	19.5%	0	0	0	+: 3/1/1 \| -: 2/0/0	1	0	0	0	Result
95	TDE0323	hypothetical protein	TDE0324	hypothetical protein	<-->	357286	357583	298	20.1%	0	0	0	+: 1/1/0 \| -: 1/0/0	1	0	0	0	Result
96	TDE0326	ATP-dependent DNA helicase RecQ	TDE0327	CRISPR-associated SAG0894 family protein	<-->	360719	361020	302	30.8%	0	0	0	+: 1/1/0 \| -: 2/1/1	1	0	0	0	Result
98	TDE0333	MATE efflux family protein	TDE0334	hypothetical protein	-><-	373144	373385	242	43.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	5	0	0	0	Result
99	TDE0337	glucosamine-6-phosphate deaminase	TDE0338	methyl-accepting chemotaxis protein-like protein	<-->	377198	377456	259	23.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
100	TDE0339	transcriptional regulator, TetR family	TDE0340	fructose-bisphosphate aldolase	->->	378629	378778	150	27.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
101	TDE0342	integral membrane protein MviN	TDE0343	hydrolase, alpha/beta fold family	<-<-	383832	384336	505	36.8%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
102	TDE0344	transcriptional regulator, AbrB family	TDE0345	methyl-accepting chemotaxis protein DmcB	<-<-	385679	385833	155	32.3%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
103	TDE0346	protease PrtB	TDE0347	methyl-accepting chemotaxis protein DmcA	<-<-	387988	388139	152	30.3%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
104	TDE0347	methyl-accepting chemotaxis protein DmcA	TDE0348	transcriptional regulator, TetR family	<-->	390330	390596	267	28.1%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
105	TDE0351	L-lactate dehydrogenase	TDE0352	ribose 5-phosphate isomerase B	<-->	396089	396346	258	31.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
106	TDE0355	hypothetical protein	TDE0356	hypothetical protein	-><-	399718	399821	104	40.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
107	TDE0358	cinnamoyl ester hydrolase	TDE0359	ABC transporter, ATP-binding/permease protein	<-<-	401729	402282	554	38.6%	0	0	2	+: 0/0/0 \| -: 1/1/1	1	0	0	0	Result
108	TDE0360	ABC transporter, ATP-binding/permease protein	TDE0361	transporter, putative	<-->	405935	406128	194	33.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
109	TDE0364	ABC transporter, ATP-binding protein	TDE0365	hypothetical protein	<-<-	411696	411812	117	26.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
110	TDE0368	type I restriction-modification system, S subunit, putative	TDE0369	type I restriction-modification system, M subunit	<-<-	418336	418445	110	40%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
111	TDE0369	type I restriction-modification system, M subunit	TDE0370	UDP-N-acetylmuramoylalanine--D-glutamate ligase	<-->	421062	421223	162	24.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
112	TDE0370	UDP-N-acetylmuramoylalanine--D-glutamate ligase	TDE0371	hypothetical protein	->->	422655	422826	172	41.3%	0	0	0	+: 0/2/0 \| -: 0/3/0	1	0	0	0	Result
113	TDE0373	ABC transporter, ATP-binding/permease protein	TDE0374	glycosyl transferase, group 1 family protein	<-<-	427813	428003	191	24.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
114	TDE0377	hypothetical protein	TDE0378	hypothetical protein	<-->	432068	432303	236	24.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
115	TDE0386	ABC transporter, periplasmic substrate-binding protein	TDE0387	(R)-hydroxyglutaryl-CoA dehydratase activator	<-->	438412	438566	155	23.2%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
116	TDE0392	(R)-2-hydroxyglutaryl-CoA dehydratase, beta subunit, putative	TDE0393	transcriptional regulator, TetR family	<-<-	443115	443271	157	20.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
117	TDE0393	transcriptional regulator, TetR family	TDE0394	oligopeptide/dipeptide ABC transporter, permease protein	<-->	443920	444120	201	25.9%	0	0	0	+: 1/1/0 \| -: 1/0/0	1	0	0	0	Result
118	TDE0402	hypothetical protein	TDE0403	hypothetical protein	<-->	454443	454572	130	30%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
119	TDE0405	major outer sheath protein	TDE0406	hypothetical protein	->->	457242	457369	128	37.5%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
120	TDE0406	hypothetical protein	TDE0407	glutamate synthase (NADPH), homotetrameric	-><-	458990	459100	111	28.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
121	TDE0408	oxidoreductase, NAD-binding	TDE0409	hypothetical protein	<-->	461463	461716	254	28.7%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
122	TDE0414	hypothetical protein	TDE0415	lipoprotein, putative	->->	467703	467806	104	23.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
123	TDE0418	lipoprotein, putative	TDE0419	hypothetical protein	->->	470954	471062	109	22.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
124	TDE0431	LysM domain protein	TDE0432	TPR domain protein, truncation	<-<-	487685	487809	125	24%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
126	TDE0433	hypothetical protein	TDE0434	rubrerythrin	<-->	488808	489048	241	29%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
127	TDE0438	queuine tRNA-ribosyltransferase	TDE0439	hypothetical protein	<-<-	494902	495193	292	38.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
128	TDE0439	hypothetical protein	TDE0440	DNA-binding protein	<-->	495914	496090	177	24.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
129	TDE0442	hypothetical protein	TDE0443	hypothetical protein	<-->	497814	498077	264	28.4%	0	0	0	+: 2/1/2 \| -: 1/2/0	1	0	0	0	Result
130	TDE0445	amino acid permease	TDE0446	fibronectin type III domain protein	->->	501165	501408	244	30.7%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
131	TDE0450	hypothetical protein	TDE0451	arginine deiminase	<-->	508620	508792	173	32.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
132	TDE0456	pyridoxine biosynthesis protein	TDE0457	hypothetical protein	<-->	513475	513664	190	32.6%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
133	TDE0458	hypothetical protein	TDE0459	hypothetical protein	->->	514281	514521	241	26.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
134	TDE0462	metallo-beta-lactamase family protein	TDE0463	purine nucleoside phosphorylase	<-->	517078	517322	245	30.6%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
135	TDE0466	hypothetical protein	TDE0467	hypothetical protein	<-<-	518945	519095	151	32.5%	0	0	0	+: 0/0/0 \| -: 0/4/0	1	0	0	0	Result
136	TDE0469	hypothetical protein	TDE0470	cell division protein FtsH	<-->	524078	524640	563	33.4%	0	0	0	+: 2/2/4 \| -: 1/1/1	3	0	0	0	Result
137	TDE0470	cell division protein FtsH	TDE0471	BNR domain protein	-><-	526618	526746	129	44.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
138	TDE0471	BNR domain protein	TDE0472	hypothetical protein	<-->	528379	528515	137	25.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
139	TDE0484	methyl-accepting chemotaxis protein	TDE0485	hypothetical protein	<-<-	541907	542095	189	20.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
140	TDE0489	hypothetical protein	TDE0490	hypothetical protein	<-<-	546146	546361	216	24.1%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
141	TDE0493	hypothetical protein	TDE0494	hypothetical protein	<-<-	549433	549648	216	27.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
142	TDE0495	hypothetical protein	TDE0496	DNA-binding protein, putative	<-<-	550932	551060	129	41.9%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
143	TDE0496	DNA-binding protein, putative	TDE0497	hypothetical protein	<-<-	551280	551463	184	31%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
144	TDE0498	hypothetical protein	TDE0499	hypothetical protein	<-<-	552334	552606	273	30.8%	0	0	6	+: 0/2/0 \| -: 2/3/0	1	0	0	0	Result
145	TDE0500	hypothetical protein	TDE0501	hypothetical protein	<-<-	553777	554274	498	32.9%	0	0	0	+: 1/1/1 \| -: 1/0/0	1	0	0	0	Result
146	TDE0501	hypothetical protein	TDE0502	ankyrin repeat protein	<-<-	555403	555583	181	29.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
147	TDE0513	hypothetical protein	TDE0514	hypothetical protein	<-<-	562332	562509	178	29.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
148	TDE0518	hypothetical protein	TDE0519	hypothetical protein	<-<-	565354	565527	174	40.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
149	TDE0521	carboxylesterase family protein	TDE0522	hypothetical protein	<-->	568343	568638	296	32.4%	0	0	2	+: 1/4/0 \| -: 0/0/0	1	0	0	0	Result
150	TDE0523	hypothetical protein	TDE0524	hypothetical protein	<-->	569922	570156	235	32.3%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
151	TDE0525	hypothetical protein	TDE0526	hypothetical protein	->->	571224	571580	357	33.1%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
152	TDE0527	hypothetical protein	TDE0528	hypothetical protein	->->	573222	573345	124	22.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
153	TDE0536	hypothetical protein	TDE0537	hypothetical protein	<-->	578955	579163	209	26.8%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
154	TDE0546	hypothetical protein	TDE0547	hypothetical protein	-><-	585880	586060	181	38.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
156	TDE0559	hypothetical protein	TDE0560	hypothetical protein	->->	594187	594301	115	32.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
158	TDE0562	hypothetical protein	TDE0563	hypothetical protein	->->	595642	595871	230	38.3%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
159	TDE0568	hypothetical protein	TDE0569	hypothetical protein	->->	599289	599775	487	41.7%	0	0	0	+: 1/3/3 \| -: 0/3/0	2	0	0	0	Result
160	TDE0570	hypothetical protein	TDE0571	hypothetical protein	->->	601017	601274	258	42.2%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
161	TDE0574	surface protein, putative	TDE0575	aspartyl/glutamyl-tRNA amidotransferase subunit B	-><-	605923	606341	419	39.1%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
162	TDE0578	hypothetical protein	TDE0579	hypothetical protein	-><-	609738	609987	250	32.8%	0	0	0	+: 0/2/0 \| -: 0/2/0	2	0	0	0	Result
167	TDE0585	hypothetical protein	TDE0586	hypothetical protein	<-->	625115	625385	271	24%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
168	TDE0586	hypothetical protein	TDE0587	hypothetical protein	->->	625701	625888	188	25%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
170	TDE0590	acetyl-CoA carboxylase, carboxyl transferase, beta subunit	TDE0591	acetyl-CoA carboxylase, biotin carboxylase	<-<-	629947	630122	176	36.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
171	TDE0592	acetyl-CoA carboxylase, biotin carboxyl carrier protein	TDE0593	internalin-related protein	<-<-	632029	632130	102	29.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
172	TDE0597	hypothetical protein	TDE0598	3-oxoacyl-(acyl-carrier-protein) reductase	<-<-	637303	637447	145	38.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
173	TDE0602	3-oxoacyl-(acyl-carrier-protein) synthase III	TDE0603	hypothetical protein	<-->	640862	641027	166	24.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
174	TDE0607	ParA family ATPase	TDE0608	DNA-binding protein, putative	<-<-	644971	645083	113	18.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
175	TDE0608	DNA-binding protein, putative	TDE0609	hypothetical protein	<-<-	645258	645365	108	31.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
176	TDE0609	hypothetical protein	TDE0610	3-hydroxyacyl-CoA dehydrogenase, putative	<-<-	646257	646446	190	33.2%	0	0	0	+: 1/2/0 \| -: 0/2/0	1	0	0	0	Result
178	TDE0622	radical SAM domain protein	TDE0623	precorrin-3B C17-methyltransferase	<-->	655809	655922	114	25.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
179	TDE0626	hypothetical protein	TDE0627	co-chaperone protein GrpE	->->	659745	659984	240	34.2%	0	0	0	+: 2/2/4 \| -: 0/0/0	1	0	0	0	Result
180	TDE0639	oligopeptide/dipeptide ABC transporter, permease protein	TDE0640	methyl-accepting chemotaxis protein	<-<-	674485	674620	136	30.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
181	TDE0640	methyl-accepting chemotaxis protein	TDE0641	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	<-<-	676856	677091	236	22.9%	0	0	0	+: 0/2/0 \| -: 1/0/0	1	0	0	0	Result
183	TDE0646	hypothetical protein	TDE0647	chemotaxis protein methyltransferase	<-->	681956	682083	128	28.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
185	TDE0650	hypothetical protein	TDE0652	hypothetical protein	->->	685872	688316	2445	42.5%	0	0	249	+: 1/6/6 \| -: 2/2/2	1	0	0	0	Result
186	TDE0654	peptidase, M20/M25/M40 family	TDE0655	response regulator	->->	690919	691060	142	23.9%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
187	TDE0663	hypothetical protein	TDE0664	OmpA family protein	<-->	698188	698519	332	23.5%	0	0	0	+: 0/4/0 \| -: 2/3/4	1	0	0	0	Result
188	TDE0665	pyruvate ferredoxin/flavodoxin oxidoreductase family protein	TDE0666	FeS assembly ATPase SufC	<-->	703443	703692	250	26.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
189	TDE0669	hypothetical protein	TDE0670	ATP-dependent protease La	<-->	707918	708077	160	21.9%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
190	TDE0670	ATP-dependent protease La	TDE0671	PIN domain protein	->->	710454	710760	307	30.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
191	TDE0671	PIN domain protein	TDE0672	hypothetical protein	->->	711139	711249	111	46.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
192	TDE0673	hypothetical protein	TDE0674	hypothetical protein	->->	713174	713300	127	37%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
195	TDE0685	oxidoreductase, short chain dehydrogenase/reductase family	TDE0686	phosphoribosylaminoimidazole-succinocarboxamide synthase	<-->	722711	722866	156	26.9%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
196	TDE0692	hypothetical protein	TDE0693	phosphomethylpyrimidine kinase	->->	729981	730081	101	36.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
197	TDE0693	phosphomethylpyrimidine kinase	TDE0694	ABC transporter, ATP-binding protein	->->	730892	731129	238	31.1%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
198	TDE0697	hypothetical protein	TDE0698	PIN domain protein	<-<-	734463	734711	249	35.3%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
199	TDE0700	hypothetical protein	TDE0701	hypothetical protein	<-<-	736489	736608	120	21.7%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
200	TDE0703	transcriptional regulator, AbrB family	TDE0704	SPFH domain/Band 7 family protein	<-<-	738281	738518	238	31.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
201	TDE0705	SPFH domain/Band 7 family protein	TDE0706	adenine-specific DNA modification methyltransferase	<-->	740359	740559	201	23.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
202	TDE0712	hypothetical protein	TDE0713	transcription antitermination protein, NusG family	<-->	747054	747248	195	30.3%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
203	TDE0715	hypothetical protein	TDE0716	CAAX amino terminal protease family protein	->->	750611	750967	357	35.3%	0	0	0	+: 1/3/3 \| -: 0/2/0	5	0	0	0	Result
205	TDE0717	hypothetical protein	TDE0718	hypothetical protein	->->	752441	753354	914	30.2%	0	0	0	+: 1/1/1 \| -: 0/1/0	2	0	0	0	Result
206	TDE0721	hypothetical protein	TDE0722	lipoprotein, putative	->->	758277	758658	382	35.9%	0	0	0	+: 0/1/0 \| -: 0/1/0	2	0	0	0	Result
207	TDE0722	lipoprotein, putative	TDE0723	hypothetical protein	->->	759925	760443	519	37.8%	0	0	0	+: 1/2/2 \| -: 0/2/0	5	0	0	0	Result
208	TDE0723	hypothetical protein	TDE0724	hypothetical protein	->->	761722	761992	271	35.8%	0	0	0	+: 0/2/0 \| -: 0/1/0	5	0	0	0	Result
209	TDE0724	hypothetical protein	TDE0725	exopolysaccharide biosynthesis protein	->->	763298	763604	307	35.5%	0	0	0	+: 1/2/2 \| -: 0/1/0	5	0	0	0	Result
210	TDE0730	hypothetical protein	TDE0731	hypothetical protein	<-<-	770678	770780	103	24.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
212	TDE0736	hypothetical protein	TDE0737	hypothetical protein	<-<-	775321	775497	177	42.9%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
213	TDE0741	hypothetical protein	TDE0742	hypothetical protein	<-<-	778249	778539	291	46.4%	0	0	2	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
214	TDE0742	hypothetical protein	TDE0743	thioredoxin reductase	<-->	778726	778857	132	28%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
216	TDE0744	thioredoxin	TDE0745	glycine reductase complex selenoprotein GrdA	->->	780302	780426	125	35.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
217	TDE0745	glycine reductase complex selenoprotein GrdA	TDE0746	iron compound ABC transporter, ATP-binding protein, putative	-><-	780901	781020	120	45%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
218	TDE0748	iron compound ABC transporter, periplasmic iron compound-binding protein, putative	TDE0749	cobalamin biosynthesis protein CobN, putative	<-<-	784379	784562	184	27.7%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
219	TDE0751	magnesium chelatase, subunit D/I family	TDE0752	hypothetical protein	<-->	791142	791492	351	33.3%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
220	TDE0758	iron compound ABC transporter, periplasmic iron compound-binding protein, putative	TDE0759	hypothetical protein	<-<-	799014	799217	204	37.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
221	TDE0761	protease complex-associated polypeptide	TDE0763	hypothetical protein	-><-	802029	804323	2295	44.9%	0	1	31	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
222	TDE0764	hypothetical protein	TDE0765	translation elongation factor Tu	<-->	804618	804871	254	37.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
223	TDE0795	hypothetical protein	TDE0796	histidinol phosphate phosphatase HisJ family protein	<-->	820065	820196	132	28.8%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
224	TDE0798	transporter, putative	TDE0799	glycerophosphoryl diester phosphodiesterase, putative	<-->	822648	822748	101	20.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
225	TDE0801	hypothetical protein	TDE0802	hypothetical protein	<-<-	824450	824561	112	30.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
226	TDE0802	hypothetical protein	TDE0803	hypothetical protein	<-->	825198	825456	259	24.3%	0	0	0	+: 1/4/4 \| -: 1/1/0	1	0	0	0	Result
227	TDE0804	hypothetical protein	TDE0805	hypothetical protein	<-->	828090	828310	221	32.6%	0	0	0	+: 0/3/0 \| -: 1/0/0	1	0	0	0	Result
228	TDE0811	efflux protein, putative	TDE0812	ABC transporter, ATP-binding/permease protein	<-->	832439	832583	145	29.7%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
229	TDE0816	peptidase, M20/M25/M40 family	TDE0817	histidine kinase-related ATPase, putative	<-->	838655	838939	285	24.9%	0	0	0	+: 2/1/0 \| -: 1/0/0	1	0	0	0	Result
230	TDE0819	ABC transporter, ATP-binding/permease protein	TDE0820	transcriptional regulator, TetR family	<-<-	843476	843803	328	39.9%	0	0	0	+: 1/1/0 \| -: 0/4/0	1	0	0	0	Result
231	TDE0822	hypothetical protein	TDE0823	(3R)-hydroxymyristoyl-(acyl-carrier-protein) dehydratase, putative	->->	844730	844880	151	27.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
232	TDE0824	lipoprotein, putative	TDE0825	UDP-N-acetylmuramoylalanyl-D-glutamate-2, 6-diaminopimelate ligase, putative	<-->	845967	846101	135	17.8%	0	0	0	+: 1/1/0 \| -: 2/0/0	1	0	0	0	Result
233	TDE0827	hypothetical protein	TDE0828	glucose-inhibited division protein A	<-<-	848144	848372	229	39.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
234	TDE0829	putative aminopeptidase 2	TDE0830	hypothetical protein	<-<-	851568	851698	131	31.3%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
235	TDE0831	hypothetical protein	TDE0832	hypothetical protein	<-->	852386	852688	303	26.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
236	TDE0833	lipoprotein, putative	TDE0834	Na(+)-translocating NADH-quinone reductase, E subunit	-><-	854158	854380	223	41.7%	0	0	0	+: 0/2/0 \| -: 0/6/0	2	0	0	0	Result
237	TDE0841	hypothetical protein	TDE0842	cytoplasmic filament protein A	<-->	861689	861854	166	18.7%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
239	TDE0845	conserved hypothetical protein TIGR00266	TDE0846	hypothetical protein	->->	868610	868762	153	38.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
240	TDE0846	hypothetical protein	TDE0847	hypothetical protein	->->	870926	871033	108	35.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
241	TDE0848	hypothetical protein	TDE0849	hypothetical protein	->->	871619	871738	120	36.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
242	TDE0850	methyl-accepting chemotaxis protein	TDE0851	hypothetical protein	<-<-	874636	874838	203	23.2%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
243	TDE0861	tyrosyl-tRNA synthetase	TDE0862	hypothetical protein	<-->	883189	883331	143	20.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
245	TDE0869	hypothetical protein	TDE0870	phosphatase/nucleotidase	->->	892723	892837	115	42.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
246	TDE0876	hypothetical protein	TDE0877	hypothetical protein	<-->	898615	898728	114	27.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
247	TDE0877	hypothetical protein	TDE0878	hypothetical protein	->->	899680	899791	112	26.8%	0	0	0	+: 2/1/0 \| -: 0/0/0	1	0	0	0	Result
248	TDE0880	nicotinate-nucleotide-dimethylbenzimidazole phosphoribosyltransferase	TDE0881	ribosomal protein S16	->->	901197	901306	110	32.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
249	TDE0888	hypothetical protein	TDE0889	hypothetical protein	<-->	905066	905229	164	28.7%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
250	TDE0889	hypothetical protein	TDE0890	hypothetical protein	->->	905875	906029	155	29.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
251	TDE0895	transcriptional regulator, AraC family	TDE0896	ABC transporter, ATP-binding/permease protein	<-->	912265	912465	201	24.4%	0	0	0	+: 1/1/1 \| -: 1/0/0	1	0	0	0	Result
252	TDE0900	ABC transporter, ATP-binding protein	TDE0901	hypothetical protein	-><-	918753	918948	196	24.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
253	TDE0902	hypothetical protein	TDE0903	ATP-dependent DNA helicase PcrA	<-->	920223	920367	145	30.3%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
254	TDE0908	ABC transporter, ATP-binding/permease protein	TDE0909	type II DNA modification methyltransferase M.TdeIII	->->	927146	927305	160	45%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
255	TDE0911	type II restriction endonuclease TdeIII	TDE0912	hypothetical protein	->->	931390	931489	100	35%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
256	TDE0912	hypothetical protein	TDE0913	hypothetical protein	-><-	931589	931785	197	27.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
257	TDE0922	ABC transporter, ATP-binding/permease protein	TDE0923	ABC transporter, ATP-binding/permease protein	<-<-	943731	944009	279	39.1%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
258	TDE0924	ABC transporter, ATP-binding/permease protein	TDE0925	peptidase T	<-->	947725	947986	262	31.7%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
260	TDE0932	adenylate/guanylate cyclase catalytic domain protein	TDE0933	acetate kinase	<-->	958035	958202	168	25%	0	0	0	+: 3/0/0 \| -: 1/0/0	1	0	0	0	Result
261	TDE0935	hypothetical protein	TDE0936	hypothetical protein	<-<-	959844	959961	118	29.7%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
262	TDE0937	RNA polymerase sigma-70 factor family protein	TDE0938	hypothetical protein	-><-	960952	961052	101	38.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
263	TDE0942	long-chain-fatty-acid--CoA ligase, putative	TDE0943	hypothetical protein	->->	966000	966122	123	35.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
264	TDE0944	hypothetical protein	TDE0945	hypothetical protein	->->	967098	967267	170	43.5%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
265	TDE0947	translation elongation factor G, putative	TDE0948	hypothetical protein	<-<-	970883	971048	166	28.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
266	TDE0948	hypothetical protein	TDE0949	enolase	<-->	971928	972149	222	30.2%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
267	TDE0949	enolase	TDE0950	hypothetical protein	-><-	973452	974255	804	27%	0	0	0	+: 2/0/0 \| -: 1/1/0	1	0	0	0	Result
268	TDE0968	translation elongation factor P	TDE0969	hypothetical protein	<-->	993217	993399	183	30.6%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
269	TDE0969	hypothetical protein	TDE0970	hypothetical protein	->->	994636	994908	273	38.5%	0	0	0	+: 0/5/0 \| -: 0/3/0	5	0	0	0	Result
270	TDE0973	DNA repair protein RadC	TDE0974	hypothetical protein	<-->	998708	998833	126	27%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
271	TDE0974	hypothetical protein	TDE0975	hypothetical protein	->->	998936	999060	125	35.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
272	TDE0975	hypothetical protein	TDE0976	hypothetical protein	->->	999940	1000165	226	47.3%	0	0	0	+: 0/2/0 \| -: 0/3/0	2	0	0	0	Result
273	TDE0977	hypothetical protein	TDE0978	hypothetical protein	->->	1001701	1002007	307	50.8%	0	0	1	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
274	TDE0978	hypothetical protein	TDE0979	penicillin binding protein	-><-	1002485	1002599	115	32.2%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
275	TDE0980	asparaginyl-tRNA synthetase	TDE0981	hypothetical protein	<-->	1005491	1005635	145	25.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
276	TDE0982	dihydroorotate dehydrogenase/oxidoreductase, FAD-binding	TDE0984	oligopeptide/dipeptide ABC transporter, permease protein, putative	->->	1008393	1009613	1221	37.8%	0	7	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
277	TDE0988	oligopeptide/dipeptide ABC transporter, peptide-binding protein	TDE0989	hypothetical protein	->->	1017166	1017271	106	24.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
279	TDE0993	lipoprotein, putative	TDE0994	hypothetical protein	<-->	1020506	1020677	172	26.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
280	TDE0998	hypothetical protein	TDE0999	formate/nitrite transporter	->->	1025555	1026009	455	38%	0	0	0	+: 1/1/1 \| -: 1/0/0	1	0	0	0	Result
281	TDE1004	flagellar filament core protein	TDE1005	hypothetical protein	<-->	1030227	1030345	119	44.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
282	TDE1008	flagellar protein, putative	TDE1009	methyl-accepting chemotaxis protein	-><-	1032867	1033092	226	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
283	TDE1009	methyl-accepting chemotaxis protein	TDE1010	excinuclease ABC, A subunit	<-->	1035187	1035366	180	23.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
287	TDE1024	conserved hypothetical protein TIGR01319	TDE1025	ribosomal protein L32	->->	1057095	1057240	146	31.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
288	TDE1027	ribonuclease III	TDE1028	hypothetical protein	->->	1058443	1058583	141	20.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
289	TDE1038	hypothetical protein	TDE1039	riboflavin biosynthesis protein, putative	<-->	1067067	1067211	145	29%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
290	TDE1040	ribosomal protein S15	TDE1041	polyribonucleotide nucleotidyltransferase	->->	1068349	1068463	115	28.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
291	TDE1046	hypothetical protein	TDE1047	30S ribosomal protein S12	->->	1074137	1074236	100	32%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
292	TDE1048	30S ribosomal protein S7	TDE1049	elongation factor EF-2	->->	1075093	1075426	334	33.8%	0	0	0	+: 1/4/0 \| -: 1/6/0	1	0	0	0	Result
293	TDE1051	hypothetical protein	TDE1052	rubredoxin	<-<-	1078587	1078801	215	46%	0	0	0	+: 0/0/0 \| -: 0/1/0	3	0	0	0	Result
294	TDE1053	lipoprotein, putative	TDE1054	methyl-accepting chemotaxis protein	<-->	1080817	1080979	163	17.2%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
295	TDE1055	MATE efflux family protein	TDE1056	hypothetical protein	<-->	1084422	1085349	928	40.3%	0	0	9	+: 3/3/0 \| -: 2/7/14	2	0	0	0	Result
296	TDE1056	hypothetical protein	TDE1057	hypothetical protein	-><-	1085956	1086194	239	31.8%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
297	TDE1058	hypothetical protein	TDE1059	hypothetical protein	<-<-	1086457	1086587	131	50.4%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
298	TDE1065	hypothetical protein	TDE1066	hypothetical protein	<-<-	1094242	1094424	183	27.9%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
299	TDE1071	peptide ABC transporter, peptide-binding protein OppA	TDE1072	lipoprotein, putative	<-->	1100679	1100880	202	23.8%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
300	TDE1072	lipoprotein, putative	TDE1073	oligopeptide/dipeptide ABC transporter, permease protein	->->	1103497	1103654	158	36.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
301	TDE1076	oligopeptide/dipeptide ABC transporter, ATP-binding protein	TDE1077	hypothetical protein	->->	1108117	1108534	418	33.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
302	TDE1077	hypothetical protein	TDE1078	metallo-beta-lactamase family protein	->->	1109741	1109878	138	31.9%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
303	TDE1078	metallo-beta-lactamase family protein	TDE1079	DNA-binding protein/PTS system, IIA component	->->	1111106	1111259	154	29.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
304	TDE1089	hypothetical protein	TDE1090	threonyl-tRNA synthetase	<-->	1121035	1121245	211	27%	0	0	0	+: 0/1/0 \| -: 1/2/0	1	0	0	0	Result
305	TDE1090	threonyl-tRNA synthetase	TDE1091	hypothetical protein	-><-	1123004	1123106	103	37.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
306	TDE1092	hypothetical protein	TDE1093	hypothetical protein	<-->	1127256	1127513	258	34.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
307	TDE1094	hypothetical protein	TDE1095	alanine racemase	->->	1129783	1129965	183	36.6%	0	0	0	+: 1/1/0 \| -: 0/2/0	1	0	0	0	Result
308	TDE1101	acetyltransferase, GNAT family	TDE1102	hypothetical protein	<-<-	1135233	1135353	121	29.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
309	TDE1102	hypothetical protein	TDE1103	hypothetical protein	<-->	1136266	1136499	234	26.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
310	TDE1108	hypothetical protein	TDE1109	decarboxylase, pyridoxal-dependent family	<-->	1142950	1143219	270	28.1%	0	0	0	+: 1/0/0 \| -: 1/2/0	1	0	0	0	Result
311	TDE1112	adenylate kinase	TDE1113	hypothetical protein	-><-	1147688	1147818	131	35.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
312	TDE1114	transcriptional regulator, TetR family	TDE1115	DNA-binding protein, putative	<-<-	1148996	1149127	132	33.3%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
313	TDE1118	tyrosine phenol-lyase	TDE1119	hypothetical protein	<-->	1151352	1151466	115	27.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
314	TDE1132	chorismate synthase	TDE1133	hypothetical protein	-><-	1164641	1164842	202	27.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
316	TDE1139	hypothetical protein	TDE1140	hypothetical protein	<-<-	1168706	1168819	114	48.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
317	TDE1146	hypothetical protein	TDE1147	hypothetical protein	<-<-	1185505	1185618	114	29.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
318	TDE1155	hypothetical protein	TDE1156	hypothetical protein	<-<-	1191546	1191710	165	32.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
320	TDE1157	phage terminase, large subunit, putative	TDE1158	phage terminase, small subunit, putative	<-<-	1193384	1193502	119	38.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
323	TDE1174	hypothetical protein	TDE1175	chaperonin GroEL	<-<-	1203491	1203606	116	20.7%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
324	TDE1175	chaperonin GroEL	TDE1176	oxygen-independent coproporphyrinogen III oxidase, putative	<-<-	1205242	1205371	130	33.8%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
325	TDE1180	iron compound ABC transporter, periplasmic iron compound-binding protein	TDE1181	methyltransferase domain protein	<-->	1209924	1210031	108	25.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
326	TDE1184	hypothetical protein	TDE1185	lipoprotein, putative	-><-	1211582	1211686	105	38.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
327	TDE1186	hypothetical protein	TDE1187	hypothetical protein	<-->	1213576	1213727	152	30.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
328	TDE1188	NAD(P) transhydrogenase, beta subunit	TDE1190	hypothetical protein	<-->	1216713	1218362	1650	41.7%	0	1	0	+: 2/0/0 \| -: 1/3/0	1	0	0	0	Result
329	TDE1191	hypothetical protein	TDE1192	hypothetical protein	->->	1219279	1219471	193	32.6%	0	0	0	+: 1/0/0 \| -: 1/1/0	2	0	0	0	Result
334	TDE1204	cell division protein FtsZ	TDE1205	integrase/recombinase XerD	->->	1237727	1237828	102	35.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
335	TDE1231	hypothetical protein	TDE1232	hypothetical protein	<-<-	1265294	1265442	149	27.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
336	TDE1232	hypothetical protein	TDE1233	hypothetical protein	<-->	1267123	1267342	220	45.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
337	TDE1234	hypothetical protein	TDE1235	hypothetical protein	<-->	1269407	1269515	109	31.2%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
338	TDE1236	triosephosphate isomerase	TDE1237	hypothetical protein	->->	1270379	1270507	129	26.4%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
339	TDE1245	hypothetical protein	TDE1246	lipoprotein, putative	<-->	1278985	1279178	194	32.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
340	TDE1247	hypothetical protein	TDE1248	hypothetical protein	->->	1282486	1282735	250	44.4%	0	0	0	+: 1/0/0 \| -: 0/2/0	1	0	0	0	Result
341	TDE1259	amino acid carrier family protein	TDE1260	cholinephosphate cytidylyltransferase/choline kinase	<-->	1293761	1294167	407	29.7%	0	0	1	+: 1/0/0 \| -: 3/1/2	1	0	0	0	Result
342	TDE1276	hypothetical protein	TDE1277	Fe-hydrogenase large subunit family protein	<-->	1310710	1310820	111	32.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
343	TDE1279	phosphoribosylformylglycinamidine synthase II	TDE1280	hypothetical protein	<-<-	1315206	1315839	634	38.6%	0	0	6	+: 3/2/2 \| -: 1/0/0	1	0	0	0	Result
344	TDE1287	transcription-repair coupling factor	TDE1288	CAAX amino terminal protease family protein	->->	1326346	1326456	111	32.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
345	TDE1288	CAAX amino terminal protease family protein	TDE1289	hypothetical protein	->->	1327336	1327453	118	17.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
346	TDE1291	HD domain protein	TDE1292	TldD/PmbA family protein	<-<-	1329304	1329403	100	37%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
347	TDE1294	phosphocarrier protein HPr	TDE1296	ribosomal subunit interface protein, putative	<-<-	1332412	1333553	1142	39.2%	0	0	117	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
348	TDE1296	ribosomal subunit interface protein, putative	TDE1297	LysM domain/M23/M37 peptidase domain protein	<-<-	1333845	1333966	122	29.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
349	TDE1298	cyclic nucleotide binding domain protein	TDE1299	hypothetical protein	<-<-	1335406	1335506	101	37.6%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
350	TDE1304	hypothetical protein	TDE1305	DNA-binding protein	->->	1340009	1340239	231	34.6%	0	0	1	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
351	TDE1306	hypothetical protein	TDE1307	hypothetical protein	<-->	1340965	1341093	129	29.5%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
352	TDE1310	modulator of DNA gyrase family protein	TDE1311	ABC transporter, ATP-binding/permease protein	->->	1347401	1347510	110	39.1%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
353	TDE1311	ABC transporter, ATP-binding/permease protein	TDE1312	hypothetical protein	->->	1349116	1349227	112	33.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
354	TDE1328	hypothetical protein	TDE1329	ATPase, AAA family	<-->	1363493	1363642	150	24%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
355	TDE1329	ATPase, AAA family	TDE1330	conserved hypothetical protein TIGR00244	->->	1365407	1365518	112	38.4%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
356	TDE1337	hypothetical protein	TDE1338	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	<-->	1374897	1375028	132	25.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
357	TDE1340	ribosomal 5S rRNA E-loop binding protein Ctc/L25/TL5	TDE1341	hypothetical protein	->->	1377093	1377202	110	30%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
358	TDE1343	trypsin domain/PDZ domain protein	TDE1344	hypothetical protein	->->	1382297	1382531	235	25.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
359	TDE1344	hypothetical protein	TDE1345	DNA primase	->->	1383411	1383578	168	38.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
360	TDE1347	hypothetical protein	TDE1348	TPR domain protein	->->	1388093	1388472	380	43.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
361	TDE1359	hypothetical protein	TDE1360	xanthine/uracil permease family protein	<-->	1399255	1399436	182	19.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
362	TDE1363	nitroreductase family protein	TDE1364	valyl-tRNA synthetase	<-->	1404726	1404902	177	29.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
363	TDE1364	valyl-tRNA synthetase	TDE1365	transcriptional regulator, TetR family	->->	1407633	1407894	262	28.2%	0	0	0	+: 1/2/2 \| -: 0/0/0	1	0	0	0	Result
364	TDE1372	hypothetical protein	TDE1373	HD domain protein	<-<-	1416988	1417268	281	34.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
365	TDE1374	hypothetical protein	TDE1375	pantetheine-phosphate adenylyltransferase	<-->	1418089	1418220	132	31.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
366	TDE1381	V-type ATP synthase subunit E	TDE1382	transcriptional regulator, ArsR family	<-->	1421996	1422139	144	23.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
367	TDE1401	DedA family protein	TDE1402	hypothetical protein	->->	1443129	1443297	169	25.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
368	TDE1407	hypothetical protein	TDE1408	flagellar filament outer layer protein FlaA, putative	<-->	1450762	1450968	207	26.6%	0	0	0	+: 2/0/0 \| -: 1/1/0	1	0	0	0	Result
369	TDE1409	flagellar filament outer layer protein FlaA, putative	TDE1410	hypothetical protein	-><-	1452442	1452563	122	25.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
370	TDE1411	hypothetical protein	TDE1412	sodium/hydrogen exchanger family protein	<-->	1453493	1453601	109	27.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
371	TDE1412	sodium/hydrogen exchanger family protein	TDE1413	cytidylyltransferase/phosphoenolpyruvate phosphomutase, putative	->->	1455327	1455649	323	29.7%	0	0	0	+: 1/3/0 \| -: 0/2/0	1	0	0	0	Result
372	TDE1455	prevent-host-death family protein	TDE1456	GGDEF domain protein	-><-	1503272	1503401	130	27.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
374	TDE1470	hypothetical protein	TDE1471	hypothetical protein	<-<-	1518117	1518234	118	46.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
375	TDE1473	flagellin FlaG, putative	TDE1474	hypothetical protein	<-<-	1521222	1521350	129	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
376	TDE1477	flagellar filament core protein	TDE1478	hypothetical protein	<-<-	1523424	1523564	141	29.1%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
377	TDE1480	hypothetical protein	TDE1481	hypothetical protein	<-->	1525672	1525796	125	28%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
378	TDE1481	hypothetical protein	TDE1482	peptidase, M24 family protein	->->	1526934	1527035	102	23.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
380	TDE1483	hypothetical protein	TDE1484	hypothetical protein	->->	1529128	1529294	167	25.7%	0	0	0	+: 1/0/0 \| -: 0/2/0	1	0	0	0	Result
381	TDE1487	conserved hypothetical protein TIGR01033	TDE1488	glyceraldehyde-3-phosphate dehydrogenase, type I	-><-	1531589	1531693	105	33.3%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
383	TDE1495	hypothetical protein	TDE1496	chromosome partition protein SmC, putative	<-->	1540307	1540424	118	28.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
385	TDE1507	L-serine dehydratase, iron-sulfur-dependent, beta subunit	TDE1508	hypothetical protein	<-->	1555815	1556115	301	25.2%	0	0	0	+: 1/2/2 \| -: 1/3/2	1	0	0	0	Result
387	TDE1518	permease, putative	TDE1519	hypothetical protein	->->	1565636	1565740	105	26.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
388	TDE1530	hypothetical protein	TDE1531	hypothetical protein	<-->	1575963	1576090	128	23.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
389	TDE1547	ribonuclease HII	TDE1548	conserved hypothetical protein TIGR00103	->->	1591861	1591974	114	17.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
390	TDE1551	lipoyltransferase and lipoate-protein ligase family protein	TDE1552	hypothetical protein	<-->	1595624	1595898	275	26.5%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
391	TDE1559	hypothetical protein	TDE1560	YD repeat protein	->->	1611472	1611589	118	22%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
392	TDE1562	hypothetical protein	TDE1563	hypothetical protein	->->	1615706	1615832	127	31.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
393	TDE1564	hypothetical protein	TDE1565	hypothetical protein	->->	1616765	1617032	268	32.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
395	TDE1569	hypothetical protein	TDE1570	hypothetical protein	->->	1620036	1620201	166	31.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
396	TDE1570	hypothetical protein	TDE1571	hypothetical protein	->->	1620667	1620807	141	25.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
397	TDE1576	tRNA-i(6)A37 modification enzyme MiaB	TDE1577	lipoprotein, putative	->->	1624274	1624648	375	24.8%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
398	TDE1584	lipoprotein, putative	TDE1585	hypothetical protein	-><-	1632915	1633021	107	40.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
399	TDE1586	hypothetical protein	TDE1587	aspartyl-tRNA synthetase	<-->	1634011	1634172	162	21.6%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
400	TDE1588	tryptophanyl-tRNA synthetase	TDE1589	purine-binding chemotaxis protein	->->	1637027	1637143	117	29.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
401	TDE1594	pyridine nucleotide-disulphide oxidoreductase family protein	TDE1595	cobalamin biosynthesis protein CbiD	<-<-	1644913	1645037	125	23.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
403	TDE1602	hypothetical protein	TDE1603	ABC transporter, ATP-binding protein	<-<-	1653348	1653500	153	32.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
404	TDE1606	transcriptional regulator, TetR family	TDE1607	MutT/nudix family protein	<-<-	1656949	1657096	148	29.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
405	TDE1610	DNA-binding protein	TDE1611	hypothetical protein	<-->	1659587	1659840	254	23.2%	0	0	0	+: 1/0/0 \| -: 2/1/0	1	0	0	0	Result
406	TDE1611	hypothetical protein	TDE1612	phosphoribosyl transferase domain protein	->->	1660495	1660688	194	41.8%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
407	TDE1617	hypothetical protein	TDE1618	hypothetical protein	<-->	1664950	1665439	490	27.8%	0	0	0	+: 3/0/0 \| -: 1/0/0	1	0	0	0	Result
408	TDE1619	hypothetical protein	TDE1620	hypothetical protein	-><-	1666659	1667048	390	43.1%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
409	TDE1628	hypothetical protein	TDE1629	dihydrolipoamide dehydrogenase	<-<-	1676947	1677242	296	28.7%	0	0	0	+: 1/3/0 \| -: 3/3/5	1	0	0	0	Result
410	TDE1629	dihydrolipoamide dehydrogenase	TDE1630	hypothetical protein	<-<-	1678605	1678731	127	26.8%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
412	TDE1635	hypothetical protein	TDE1636	surface antigen, putative	<-<-	1683410	1683606	197	28.9%	0	0	0	+: 0/0/0 \| -: 1/2/2	1	0	0	0	Result
413	TDE1636	surface antigen, putative	TDE1637	DNA polymerase I	<-->	1686046	1686211	166	28.9%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
414	TDE1641	ribose 5-phosphate isomerase A	TDE1642	hypothetical protein	-><-	1692737	1692860	124	25%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
415	TDE1651	BioY family protein	TDE1652	ABC transporter, ATP-binding/permease protein	<-<-	1698823	1698946	124	35.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
416	TDE1652	ABC transporter, ATP-binding/permease protein	TDE1654	ATP-dependent helicase HrpA, putative	<-->	1700615	1702358	1744	31.5%	0	70	10	+: 1/5/2 \| -: 4/1/1	1	0	0	0	Result
417	TDE1654	ATP-dependent helicase HrpA, putative	TDE1655	hypothetical protein	->->	1704972	1705097	126	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
418	TDE1660	leucine Rich Repeat domain protein	TDE1661	hypothetical protein	<-->	1715357	1715541	185	32.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
419	TDE1665	hypothetical protein	TDE1666	hypothetical protein	<-->	1719220	1719385	166	26.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
420	TDE1667	translation initiation factor IF-2B subunit alpha	TDE1668	amino acid permease family protein	<-->	1721142	1721357	216	19.4%	0	0	0	+: 1/0/0 \| -: 3/0/0	1	0	0	0	Result
422	TDE1675	ribosomal protein L9	TDE1676	ribosomal protein S18	<-<-	1729333	1729462	130	36.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
423	TDE1678	ribosomal protein S6	TDE1679	ATP synthase subunit K	<-<-	1730574	1730716	143	44.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
426	TDE1690	hypothetical protein	TDE1691	hypothetical protein	<-<-	1747291	1747496	206	35.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
427	TDE1694	hypothetical protein	TDE1695	CoA-substrate-specific enzyme activase domain protein	<-<-	1749457	1749587	131	29%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
428	TDE1699	hypothetical protein	TDE1700	hypothetical protein	<-->	1758011	1758179	169	22.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
429	TDE1711	RelA/SpoT domain protein	TDE1712	flagellar filament outer layer protein	<-<-	1766809	1766955	147	36.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
430	TDE1716	glyoxalase family protein	TDE1717	hypothetical protein	<-->	1771319	1771570	252	25%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
431	TDE1718	GMP synthase	TDE1719	transcriptional regulator, MarR family	->->	1773872	1774168	297	30%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
432	TDE1722	hypothetical protein	TDE1723	hypothetical protein	->->	1776579	1776774	196	25.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
433	TDE1725	hypothetical protein	TDE1726	polyA polymerase family protein	<-->	1779368	1779685	318	29.9%	0	0	0	+: 2/1/2 \| -: 1/1/0	1	0	0	0	Result
434	TDE1731	hypothetical protein	TDE1732	hypothetical protein	<-->	1787026	1787169	144	29.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
442	TDE1765	hypothetical protein	TDE1766	hypothetical protein	<-<-	1811969	1812364	396	28%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
443	TDE1766	hypothetical protein	TDE1767	hypothetical protein	<-<-	1812824	1813015	192	36.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
444	TDE1767	hypothetical protein	TDE1768	hypothetical protein	<-<-	1813658	1813758	101	36.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
446	TDE1772	hypothetical protein	TDE1773	hypothetical protein	<-<-	1815908	1816498	591	32.5%	0	0	0	+: 2/2/4 \| -: 0/2/0	1	0	0	0	Result
447	TDE1773	hypothetical protein	TDE1774	hypothetical protein	<-<-	1817192	1817589	398	32.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	3	0	0	0	Result
448	TDE1774	hypothetical protein	TDE1775	hypothetical protein	<-<-	1817980	1818159	180	25%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
449	TDE1775	hypothetical protein	TDE1776	hypothetical protein	<-<-	1818268	1818503	236	33.5%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
450	TDE1776	hypothetical protein	TDE1777	hypothetical protein	<-<-	1819323	1820045	723	31.4%	0	0	0	+: 1/6/4 \| -: 0/4/0	3	0	0	0	Result
451	TDE1779	hypothetical protein	TDE1780	hypothetical protein	<-<-	1822087	1822272	186	30.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
452	TDE1780	hypothetical protein	TDE1781	hypothetical protein	<-<-	1822399	1822567	169	20.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
453	TDE1784	transcriptional activator, AraC family	TDE1785	hypothetical protein	<-->	1824514	1825131	618	27.8%	0	0	0	+: 2/3/4 \| -: 1/1/1	7	0	0	0	Result
454	TDE1786	hypothetical protein	TDE1787	hypothetical protein	<-<-	1826239	1826467	229	31.9%	0	0	0	+: 0/1/0 \| -: 1/0/0	5	0	0	0	Result
455	TDE1788	hypothetical protein	TDE1789	hypothetical protein	<-<-	1827006	1827427	422	25.6%	0	0	0	+: 1/0/0 \| -: 1/1/1	8	0	0	0	Result
456	TDE1790	hypothetical protein	TDE1791	hypothetical protein	<-<-	1828098	1828397	300	33%	0	0	0	+: 0/1/0 \| -: 0/1/0	2	0	0	0	Result
457	TDE1791	hypothetical protein	TDE1792	hypothetical protein	<-<-	1828866	1829000	135	41.5%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
458	TDE1792	hypothetical protein	TDE1793	hydrolase, carbon-nitrogen family	<-<-	1829886	1830046	161	32.9%	0	0	0	+: 1/1/0 \| -: 0/0/0	2	0	0	0	Result
459	TDE1793	hydrolase, carbon-nitrogen family	TDE1794	hypothetical protein	<-<-	1830935	1831104	170	42.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
460	TDE1794	hypothetical protein	TDE1795	funZ protein, putative	<-<-	1833049	1833152	104	48.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
461	TDE1796	hypothetical protein	TDE1797	hypothetical protein	<-<-	1835606	1835744	139	39.6%	0	0	0	+: 0/1/0 \| -: 0/3/0	2	0	0	0	Result
462	TDE1797	hypothetical protein	TDE1798	hypothetical protein	<-<-	1836363	1836550	188	33.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	2	0	0	0	Result
464	TDE1802	hypothetical protein	TDE1803	hypothetical protein	<-<-	1838199	1838484	286	42%	0	0	0	+: 1/1/0 \| -: 2/1/1	4	0	0	0	Result
465	TDE1803	hypothetical protein	TDE1804	hypothetical protein	<-<-	1839361	1839565	205	35.6%	0	0	0	+: 1/3/0 \| -: 0/2/0	1	0	0	0	Result
466	TDE1805	radical SAM domain protein	TDE1806	hypothetical protein	<-<-	1842947	1843279	333	30.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
467	TDE1807	hypothetical protein	TDE1808	hypothetical protein	<-<-	1843857	1844173	317	28.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
468	TDE1808	hypothetical protein	TDE1809	hypothetical protein	<-<-	1845140	1845304	165	40%	0	0	0	+: 0/1/0 \| -: 0/0/0	2	0	0	0	Result
469	TDE1809	hypothetical protein	TDE1810	hypothetical protein	<-<-	1845404	1846013	610	26.1%	0	0	0	+: 0/5/0 \| -: 0/0/0	8	0	0	0	Result
470	TDE1810	hypothetical protein	TDE1811	hypothetical protein	<-<-	1846509	1846862	354	28%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
471	TDE1813	hypothetical protein	TDE1814	hypothetical protein	<-<-	1848340	1848518	179	34.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	2	0	0	0	Result
472	TDE1814	hypothetical protein	TDE1815	hypothetical protein	<-<-	1849404	1849547	144	31.2%	0	0	0	+: 1/1/0 \| -: 0/0/0	2	0	0	0	Result
473	TDE1815	hypothetical protein	TDE1816	hypothetical protein	<-<-	1850235	1850566	332	26.5%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
474	TDE1817	hypothetical protein	TDE1818	hypothetical protein	<-<-	1852690	1852921	232	33.6%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
475	TDE1818	hypothetical protein	TDE1819	hypothetical protein	<-<-	1853882	1854124	243	39.9%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
476	TDE1819	hypothetical protein	TDE1820	hypothetical protein	<-<-	1854242	1854386	145	27.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
477	TDE1820	hypothetical protein	TDE1821	hypothetical protein	<-<-	1854783	1854904	122	45.9%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
478	TDE1822	hypothetical protein	TDE1823	hypothetical protein	<-<-	1856013	1856690	678	22.3%	0	0	0	+: 1/4/3 \| -: 1/2/0	3	0	0	0	Result
479	TDE1825	hypothetical protein	TDE1826	hypothetical protein	<-<-	1858435	1858650	216	31.9%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
480	TDE1826	hypothetical protein	TDE1827	hydrolase, carbon-nitrogen family	<-<-	1859872	1860032	161	37.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
481	TDE1827	hydrolase, carbon-nitrogen family	TDE1828	hypothetical protein	<-<-	1860921	1861023	103	42.7%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
482	TDE1828	hypothetical protein	TDE1829	hypothetical protein	<-<-	1861843	1862456	614	32.6%	0	0	0	+: 0/6/0 \| -: 1/2/0	2	0	0	0	Result
483	TDE1830	hypothetical protein	TDE1831	hypothetical protein	-><-	1863846	1864504	659	23.8%	0	0	0	+: 0/6/0 \| -: 0/1/0	9	0	0	0	Result
484	TDE1831	hypothetical protein	TDE1832	hypothetical protein	<-<-	1865123	1865261	139	38.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	2	0	0	0	Result
485	TDE1832	hypothetical protein	TDE1833	hypothetical protein	<-<-	1866012	1866366	355	29.9%	0	0	0	+: 1/3/1 \| -: 0/4/0	3	0	0	0	Result
486	TDE1835	hypothetical protein	TDE1836	hypothetical protein	<-<-	1868408	1868603	196	30.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
487	TDE1838	hypothetical protein	TDE1839	hypothetical protein	<-<-	1870256	1870480	225	35.1%	0	0	0	+: 0/1/0 \| -: 1/0/0	3	0	0	0	Result
488	TDE1839	hypothetical protein	TDE1840	hypothetical protein	<-<-	1871312	1871413	102	51%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
489	TDE1842	hypothetical protein	TDE1843	hypothetical protein	<-<-	1872096	1872288	193	37.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	7	0	0	0	Result
490	TDE1843	hypothetical protein	TDE1844	DNA integrase	<-<-	1873096	1873286	191	35.6%	0	0	1	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
491	TDE1844	DNA integrase	TDE1845	hypothetical protein	<-<-	1874295	1874890	596	34.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
492	TDE1846	hypothetical protein	TDE1847	hypothetical protein	<-->	1875517	1875803	287	44.3%	0	0	0	+: 0/1/0 \| -: 1/2/0	1	0	0	0	Result
493	TDE1849	hypothetical protein	TDE1850	ABC transporter, permease protein, putative	<-<-	1878214	1878316	103	35%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
494	TDE1853	hypothetical protein	TDE1854	nucleotidyltransferase family protein	<-<-	1882173	1882481	309	28.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
495	TDE1854	nucleotidyltransferase family protein	TDE1855	hypothetical protein	<-->	1882806	1882985	180	28.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
496	TDE1857	hypothetical protein	TDE1858	transcriptional regulator, PadR family	<-->	1884541	1884771	231	19.5%	0	0	0	+: 1/0/0 \| -: 4/0/0	1	0	0	0	Result
497	TDE1870	CAAX amino terminal protease family protein	TDE1871	hypothetical protein	<-<-	1893583	1893751	169	21.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
498	TDE1877	conserved hypothetical protein TIGR00046	TDE1878	hydrolase, haloacid dehalogenase-like family	<-<-	1898524	1900049	1526	38.5%	0	1	0	+: 0/2/0 \| -: 0/3/0	1	0	0	0	Result
499	TDE1878	hydrolase, haloacid dehalogenase-like family	TDE1880	hypothetical protein	<-->	1900836	1902674	1839	45.8%	0	39	0	+: 1/3/1 \| -: 0/3/0	1	0	0	0	Result
500	TDE1889	branched-chain amino acid transport system II carrier protein	TDE1890	hypothetical protein	<-->	1910979	1911151	173	38.2%	0	0	0	+: 0/4/0 \| -: 0/1/0	1	0	0	0	Result
501	TDE1893	GTP-binding protein LepA	TDE1894	ferredoxin	<-->	1914108	1914252	145	24.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
502	TDE1904	hypothetical protein	TDE1905	hypothetical protein	<-<-	1923704	1923811	108	37%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
503	TDE1910	1-deoxy-D-xylulose-5-phosphate synthase	TDE1911	hypothetical protein	<-<-	1928928	1929032	105	40%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
504	TDE1911	hypothetical protein	TDE1912	redox-sensing transcriptional repressor Rex	<-->	1929189	1929315	127	28.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
505	TDE1915	alcohol dehydrogenase, iron-containing	TDE1916	glycerol kinase	<-<-	1933194	1933366	173	38.7%	0	0	0	+: 0/0/0 \| -: 0/3/0	6	0	0	0	Result
506	TDE1921	hypothetical protein	TDE1922	hypothetical protein	<-<-	1940820	1941002	183	29%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
507	TDE1924	hypothetical protein	TDE1925	peptidyl-prolyl cis-trans isomerase, FKBP-type	<-->	1941977	1942119	143	33.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
510	TDE1932	hypothetical protein	TDE1933	hypothetical protein	<-<-	1949500	1949689	190	25.8%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
511	TDE1934	hypothetical protein	TDE1935	hypothetical protein	->->	1952865	1953133	269	49.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	3	0	0	0	Result
512	TDE1937	hypothetical protein	TDE1938	hypothetical protein	->->	1953509	1953779	271	37.6%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
513	TDE1938	hypothetical protein	TDE1939	hypothetical protein	->->	1954647	1954766	120	30%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
516	TDE1949	ABC transporter, ATP-binding protein	TDE1950	membrane lipoprotein TmpC, putative	<-<-	1966158	1966280	123	35%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
517	TDE1950	membrane lipoprotein TmpC, putative	TDE1951	ribonuclease Z	<-<-	1967355	1967492	138	20.3%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
518	TDE1953	transcriptional regulator, TetR family	TDE1954	prevent-host-death family protein	<-->	1969762	1969925	164	26.2%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
519	TDE1955	hypothetical protein	TDE1956	hypothetical protein	<-->	1970991	1971253	263	31.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
520	TDE1956	hypothetical protein	TDE1957	hypothetical protein	->->	1971443	1971588	146	28.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
521	TDE1957	hypothetical protein	TDE1958	surface protein, putative	-><-	1972294	1972398	105	34.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
522	TDE1958	surface protein, putative	TDE1959	hypothetical protein	<-<-	1973776	1973894	119	26.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
523	TDE1959	hypothetical protein	TDE1960	hypothetical protein	<-->	1974288	1974437	150	31.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
524	TDE1962	hypothetical protein	TDE1963	selenocysteine-specific translation elongation factor	<-->	1975295	1975428	134	39.6%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
525	TDE1964	Na/Pi cotransporter family protein	TDE1965	sodium/hydrogen exchanger family protein	<-<-	1978871	1978984	114	35.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
526	TDE1965	sodium/hydrogen exchanger family protein	TDE1966	trypsin domain/PDZ domain protein	<-->	1980242	1980412	171	32.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
527	TDE1975	hypothetical protein	TDE1976	hypothetical protein	->->	1989117	1989254	138	22.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
528	TDE1977	hypothetical protein	TDE1978	hypothetical protein	-><-	1991409	1991590	182	41.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
529	TDE1981	hypothetical protein	TDE1982	hypothetical protein	-><-	1992498	1992600	103	46.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
530	TDE1982	hypothetical protein	TDE1983	hypothetical protein	<-<-	1993075	1993465	391	32.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	2	0	0	0	Result
532	TDE1990	ATP-dependent helicase, DinG family	TDE1991	hypothetical protein	<-<-	2008587	2008723	137	28.5%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
533	TDE1991	hypothetical protein	TDE1992	OmpA family protein	<-->	2009489	2009603	115	22.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
534	TDE1997	hypothetical protein	TDE1998	phosphohexose mutase family protein	->->	2015317	2015439	123	32.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
535	TDE1999	DNA polymerase III domain protein	TDE2000	ABC transporter, ATP-binding/permease protein, HlyB family	->->	2017857	2017998	142	30.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
536	TDE2000	ABC transporter, ATP-binding/permease protein, HlyB family	TDE2001	oligoendopeptidase F, putative	-><-	2019700	2019864	165	27.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
537	TDE2002	hypothetical protein	TDE2003	internalin-related protein	<-->	2022286	2022416	131	29.8%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
538	TDE2009	hypothetical protein	TDE2010	hypothetical protein	->->	2031308	2031457	150	42%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
539	TDE2011	hypothetical protein	TDE2012	hypothetical protein	-><-	2033543	2033889	347	36.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
540	TDE2013	hypothetical protein	TDE2014	ankyrin repeat protein	<-<-	2034797	2035524	728	36.5%	0	0	7	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
541	TDE2015	lipoprotein, putative	TDE2016	hypothetical protein	<-<-	2037623	2037913	291	20.3%	0	0	0	+: 0/1/0 \| -: 2/2/0	1	0	0	0	Result
542	TDE2016	hypothetical protein	TDE2017	hypothetical protein	<-<-	2038985	2039112	128	26.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
543	TDE2017	hypothetical protein	TDE2018	lipoprotein, putative	<-<-	2039488	2039677	190	17.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
544	TDE2022	YD repeat protein	TDE2023	TPR domain protein	<-<-	2049313	2049594	282	23.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
545	TDE2026	hypothetical protein	TDE2027	hypothetical protein	<-->	2052593	2052788	196	28.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
546	TDE2028	OmpA family protein	TDE2029	hydrolase, TatD family	-><-	2057080	2057237	158	40.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
550	TDE2045	hypothetical protein	TDE2047	hypothetical protein	<-<-	2075024	2076147	1124	42.3%	0	3	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
551	TDE2047	hypothetical protein	TDE2048	hypothetical protein	<-->	2076442	2076550	109	33%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
552	TDE2051	hypothetical protein	TDE2052	aminotransferase, class V	<-->	2080389	2080541	153	32%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
553	TDE2058	hypothetical protein	TDE2059	hypothetical protein	<-<-	2086263	2086398	136	27.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
554	TDE2065	FeoA family protein	TDE2066	exodeoxyribonuclease VII, small subunit	<-->	2091870	2092045	176	29%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
556	TDE2068	antigen, putative	TDE2069	endoribonuclease L-PSP, putative	->->	2096656	2096771	116	37.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
557	TDE2070	hypothetical protein	TDE2071	hypothetical protein	->->	2098273	2098380	108	25%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
558	TDE2071	hypothetical protein	TDE2072	hypothetical protein	->->	2098654	2098952	299	26.4%	0	0	0	+: 1/1/1 \| -: 0/2/0	1	0	0	0	Result
559	TDE2083	anti-anti-sigma factor	TDE2084	RNA methyltransferase, TrmH family	<-->	2113254	2113533	280	22.1%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
561	TDE2090	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	TDE2091	amino acid ABC transporter, amino acid-binding protein, putative	<-->	2118727	2118852	126	25.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
562	TDE2094	hypothetical protein	TDE2095	hypothetical protein	<-->	2121410	2121888	479	33.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
563	TDE2097	hypothetical protein	TDE2098	hypothetical protein	<-<-	2124832	2125040	209	34.4%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
565	TDE2102	hypothetical protein	TDE2103	glycosyl transferase, group 2 family protein	<-<-	2127438	2127616	179	38%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
566	TDE2103	glycosyl transferase, group 2 family protein	TDE2104	hypothetical protein	<-<-	2128484	2128614	131	61.1%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
567	TDE2104	hypothetical protein	TDE2105	hypothetical protein	<-<-	2131174	2131295	122	27%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
568	TDE2116	hypothetical protein	TDE2117	hypothetical protein	<-->	2147799	2147945	147	21.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
569	TDE2118	DNA topoisomerase IV subunit A	TDE2119	glycine reductase complex selenoprotein GrdB2	<-<-	2151356	2151487	132	37.1%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
570	TDE2120	glycine reductase complex proprotein GrdE2	TDE2121	hypothetical protein	<-<-	2154085	2154201	117	20.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
571	TDE2122	DHH superfamily protein	TDE2123	hypothetical protein	<-->	2156001	2156163	163	21.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
572	TDE2133	cobalt transport protein, putative	TDE2134	hypothetical protein	<-->	2164414	2164586	173	42.8%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
573	TDE2136	hypothetical protein	TDE2137	hypothetical protein	<-->	2165750	2166264	515	35.5%	0	0	0	+: 1/0/0 \| -: 0/3/0	2	0	0	0	Result
574	TDE2139	hypothetical protein	TDE2140	protease II	-><-	2172958	2173172	215	44.2%	0	0	0	+: 0/1/0 \| -: 0/1/0	3	0	0	0	Result
575	TDE2140	protease II	TDE2141	hypothetical protein	<-<-	2175231	2175672	442	35.5%	0	0	0	+: 1/1/1 \| -: 1/0/0	1	0	0	0	Result
576	TDE2142	methyl-accepting chemotaxis protein	TDE2143	penicillin-binding protein	->->	2178048	2178246	199	39.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
578	TDE2156	translation initiation factor IF-3	TDE2157	ABC transporter, permease protein, putative	<-->	2190810	2191078	269	34.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
579	TDE2160	hypothetical protein	TDE2161	acetyltransferase, GNAT family	<-->	2194059	2194229	171	29.8%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
580	TDE2169	hypothetical protein	TDE2170	hypothetical protein	-><-	2201570	2201695	126	40.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
581	TDE2171	hypothetical protein	TDE2172	hypothetical protein	<-<-	2202632	2202741	110	28.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
582	TDE2173	hypothetical protein	TDE2174	hypothetical protein	<-<-	2203079	2203188	110	30%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
583	TDE2174	hypothetical protein	TDE2175	hypothetical protein	<-<-	2204125	2204227	103	27.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
584	TDE2177	hypothetical protein	TDE2178	hypothetical protein	<-<-	2206615	2206772	158	40.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
585	TDE2178	hypothetical protein	TDE2179	voltage-gated chloride channel	<-->	2208849	2209087	239	31%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
586	TDE2182	hypothetical protein	TDE2183	hypothetical protein	<-->	2215126	2215338	213	30%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
587	TDE2191	pyrimidine-nucleoside phosphorylase	TDE2192	threonine synthase	<-->	2227742	2227900	159	27.7%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
588	TDE2194	8-amino-7-oxononanoate synthase, putative	TDE2195	RNA pseudouridylate synthase family protein	<-->	2231123	2231260	138	29.7%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
589	TDE2202	membrane protein	TDE2204	Na+/H+ antiporter family protein	->->	2239665	2241308	1644	38.1%	0	0	249	+: 2/2/2 \| -: 1/2/0	1	0	0	0	Result
590	TDE2205	enoate reductase, putative	TDE2206	hypothetical protein	<-<-	2244846	2245010	165	41.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
591	TDE2207	hypothetical protein	TDE2208	conserved hypothetical protein TIGR00486	<-->	2246725	2246872	148	27.7%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
592	TDE2209	CarB family protein	TDE2210	hypothetical protein	-><-	2249361	2249483	123	45.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
593	TDE2211	hypothetical protein	TDE2212	galactokinase	<-<-	2251407	2251571	165	32.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
594	TDE2212	galactokinase	TDE2213	hypothetical protein	<-->	2252772	2252939	168	29.2%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
595	TDE2216	galactoside ABC transporter, ATP-binding protein	TDE2217	galactose/glucose-binding lipoprotein	<-<-	2256744	2256853	110	36.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
596	TDE2219	hypothetical protein	TDE2220	prolyl-tRNA synthetase	<-->	2260737	2261024	288	30.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
597	TDE2227	hypothetical protein	TDE2228	aminoacyl-histidine dipeptidase, putative	-><-	2267195	2267376	182	35.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
598	TDE2230	hypothetical protein	TDE2231	internalin-related protein	->->	2269514	2269777	264	26.5%	0	0	0	+: 1/2/0 \| -: 0/2/0	1	0	0	0	Result
599	TDE2234	iron compound ABC transporter, periplasmic iron compound-binding protein, putative	TDE2235	methylaspartate ammonia-lyase	<-<-	2273336	2273439	104	31.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
600	TDE2236	methylaspartate mutase, E subunit	TDE2237	hypothetical protein	<-<-	2276208	2276387	180	24.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
601	TDE2242	antigen, putative	TDE2243	CutC family protein	<-<-	2282125	2282303	179	29.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
602	TDE2243	CutC family protein	TDE2244	hypothetical protein	<-->	2283045	2283159	115	29.6%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
603	TDE2250	hypothetical protein	TDE2251	uracil permease	->->	2289470	2289579	110	41.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
604	TDE2256	hypothetical protein	TDE2257	5'-nucleotidase family protein	<-<-	2293478	2293592	115	40%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
605	TDE2257	5'-nucleotidase family protein	TDE2258	surface antigen BspA, putative	<-<-	2295195	2295423	229	29.7%	0	0	0	+: 0/0/0 \| -: 1/1/1	1	0	0	0	Result
606	TDE2258	surface antigen BspA, putative	TDE2259	hypothetical protein	<-<-	2296492	2296616	125	44%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
607	TDE2259	hypothetical protein	TDE2260	hypothetical protein	<-->	2297328	2297477	150	57.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
608	TDE2260	hypothetical protein	TDE2261	hypothetical protein	-><-	2297634	2298004	371	36.9%	0	0	4	+: 0/1/0 \| -: 2/0/0	1	0	0	0	Result
609	TDE2264	ABC transporter, ATP-binding/permease protein	TDE2265	hypothetical protein	<-->	2302124	2302304	181	35.4%	0	0	0	+: 0/1/0 \| -: 2/0/0	1	0	0	0	Result
610	TDE2265	hypothetical protein	TDE2266	reverse transcriptase family protein	-><-	2302695	2303131	437	36.8%	0	0	0	+: 0/4/0 \| -: 1/0/0	1	0	0	0	Result
611	TDE2267	HRDC domain protein	TDE2268	hypothetical protein	<-<-	2304555	2304911	357	43.7%	0	0	6	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
612	TDE2269	hypothetical protein	TDE2270	methyl-accepting chemotaxis protein	<-<-	2306011	2306369	359	28.7%	0	0	0	+: 0/3/0 \| -: 1/3/2	1	0	0	0	Result
614	TDE2273	hypothetical protein	TDE2274	hypothetical protein	->->	2310213	2310340	128	25.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
615	TDE2281	LysM domain protein	TDE2282	tRNA synthetase, class II family protein	<-<-	2318584	2318717	134	28.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
616	TDE2287	peptidyl-prolyl cis-trans isomerase, FKBP-type	TDE2288	hypothetical protein	<-<-	2325149	2325251	103	28.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
617	TDE2288	hypothetical protein	TDE2289	phosphoribulokinase/uridine kinase family protein	<-->	2325735	2325903	169	26%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
618	TDE2300	trypsin domain/PDZ domain protein	TDE2301	FlhB domain protein	<-->	2341525	2341648	124	20.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
619	TDE2307	seryl-tRNA synthetase	TDE2308	hypothetical protein	<-->	2345594	2345743	150	25.3%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
620	TDE2312	hypothetical protein	TDE2313	hypothetical protein	-><-	2349110	2349595	486	39.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	2	0	0	0	Result
621	TDE2317	hemolysin III	TDE2318	LysM domain/M23/M37 peptidase domain protein	<-->	2354862	2355004	143	27.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
622	TDE2323	mechanosensitive ion channel family protein	TDE2324	DNA-binding response regulator	<-->	2359175	2359327	153	31.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
623	TDE2324	DNA-binding response regulator	TDE2325	hypothetical protein	->->	2359982	2360091	110	28.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
624	TDE2327	ATP-dependent Clp protease, ATP-binding subunit ClpB	TDE2328	efflux pump component MtrF	<-->	2364718	2364873	156	25.6%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
625	TDE2330	hypothetical protein	TDE2332	hypothetical protein	-><-	2366759	2367627	869	32.1%	0	0	2	+: 1/1/0 \| -: 1/0/0	1	1	1	165	Result	aacggagaaatttctttacaaaaacagttggagtatgtaacataataaaatactccttagctatttatatttcaatcctgaattagttaaagccccttggaaaatagaaatactttgcccagagaattccaagagttctacaaggtaatccagaggagttattta
626	TDE2333	sanA protein, putative	TDE2334	hypothetical protein	<-->	2368642	2368768	127	36.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
627	TDE2334	hypothetical protein	TDE2335	ATP-dependent DNA helicase, UvrD/Rep family	->->	2369648	2369780	133	35.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
628	TDE2336	sodium/dicarboxylate symporter family protein	TDE2337	aminopeptidase	<-->	2373287	2373434	148	29.1%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
629	TDE2338	hypothetical protein	TDE2339	leucyl-tRNA synthetase	<-->	2374810	2374984	175	36.6%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
630	TDE2347	30S ribosomal protein S2	TDE2348	maf protein	<-<-	2384469	2384697	229	39.3%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
631	TDE2349	hypothetical protein	TDE2350	lipoprotein, putative	<-<-	2386031	2386142	112	29.5%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
632	TDE2350	lipoprotein, putative	TDE2351	hypothetical protein	<-->	2386752	2386872	121	30.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
633	TDE2366	high-affinity branched-chain amino acid ABC transporter, permease protein	TDE2367	transcriptional regulator, putative	<-->	2400949	2401219	271	19.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
635	TDE2377	hypothetical protein	TDE2378	ABC transporter, ATP-binding protein, putative	<-->	2407758	2407858	101	26.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
636	TDE2391	peptidyl-prolyl cis-trans isomerase	TDE2392	hypothetical protein	<-<-	2421641	2421762	122	30.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
637	TDE2394	hypothetical protein	TDE2395	Jag protein, putative	<-<-	2422703	2422833	131	48.9%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
639	TDE2400	50S ribosomal protein L34	TDE2401	hypothetical protein	<-->	2426418	2426645	228	27.2%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
640	TDE2406	TldD/PmbA family protein	TDE2407	amidophosphoribosyltransferase	<-<-	2433604	2433733	130	25.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
641	TDE2407	amidophosphoribosyltransferase	TDE2408	hypothetical protein	<-<-	2435198	2435306	109	34.9%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
642	TDE2411	glycogen phosphorylase	TDE2412	acetyltransferase, GNAT family	<-<-	2439778	2439884	107	29.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
643	TDE2418	hypothetical protein	TDE2419	hypothetical protein	<-<-	2443924	2444112	189	36.5%	0	0	0	+: 1/0/0 \| -: 0/5/0	1	0	0	0	Result
644	TDE2419	hypothetical protein	TDE2420	DNA-directed RNA polymerase beta' subunit	<-<-	2444860	2445049	190	42.6%	0	0	0	+: 0/1/0 \| -: 1/3/3	1	0	0	0	Result
645	TDE2421	DNA-directed RNA polymerase beta subunit	TDE2422	ribosomal protein L7/L12	<-<-	2452853	2453000	148	38.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
646	TDE2422	ribosomal protein L7/L12	TDE2423	ribosomal protein L10	<-<-	2453391	2453506	116	36.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
648	TDE2434	polysaccharide deacetylase family protein	TDE2435	hypothetical protein	<-<-	2465748	2465955	208	32.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
649	TDE2435	hypothetical protein	TDE2436	hypothetical protein	<-->	2466553	2466741	189	33.3%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
650	TDE2440	ABC transporter, ATP-binding/permease protein, putative	TDE2441	hypothetical protein	<-<-	2472134	2472445	312	27.2%	0	0	0	+: 0/1/0 \| -: 1/4/4	1	0	0	0	Result
651	TDE2443	hypothetical protein	TDE2444	hypothetical protein	<-<-	2473550	2473828	279	22.9%	0	0	0	+: 1/3/1 \| -: 0/1/0	1	0	0	0	Result
652	TDE2444	hypothetical protein	TDE2445	DNA-binding protein	<-->	2474303	2474421	119	20.2%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
653	TDE2445	DNA-binding protein	TDE2446	malate dehydrogenase	-><-	2474728	2474863	136	31.6%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
654	TDE2451	S-adenosylmethionine:tRNA ribosyltransferase-isomerase	TDE2452	hypothetical protein	->->	2481016	2481149	134	35.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
655	TDE2452	hypothetical protein	TDE2453	hypothetical protein	->->	2481447	2481576	130	30%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
656	TDE2453	hypothetical protein	TDE2454	hypothetical protein	-><-	2482162	2482440	279	29.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
657	TDE2454	hypothetical protein	TDE2456	hypothetical protein	<-<-	2483467	2484225	759	33.7%	0	0	33	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
658	TDE2456	hypothetical protein	TDE2457	hypothetical protein	<-<-	2484664	2484787	124	30.6%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
659	TDE2462	hypothetical protein	TDE2463	hypothetical protein	<-->	2488515	2488629	115	23.5%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
661	TDE2476	carbamate kinase	TDE2477	selenocysteine synthase	<-->	2499541	2499662	122	32.8%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
662	TDE2481	hypothetical protein	TDE2482	hypothetical protein	<-->	2505568	2505675	108	34.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
664	TDE2485	hypothetical protein	TDE2486	hypothetical protein	<-->	2509214	2509376	163	24.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
665	TDE2489	peptide chain release factor 1	TDE2490	primosomal protein N'	<-<-	2512567	2512792	226	38.1%	0	0	0	+: 0/1/0 \| -: 1/2/0	1	0	0	0	Result
666	TDE2492	hypothetical protein	TDE2493	hypothetical protein	<-<-	2516505	2516834	330	40%	0	0	0	+: 0/1/0 \| -: 1/6/5	1	0	0	0	Result
670	TDE2498	metallo-beta-lactamase family protein	TDE2499	hypothetical protein	<-<-	2523052	2523280	229	35.4%	0	0	0	+: 0/0/0 \| -: 1/2/2	2	0	0	0	Result
672	TDE2504	O-sialoglycoprotein endopeptidase	TDE2505	hypothetical protein	->->	2530158	2530264	107	23.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
673	TDE2508	hypothetical protein	TDE2509	transcriptional regulator, AraC family	->->	2533182	2533327	146	24.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
674	TDE2509	transcriptional regulator, AraC family	TDE2510	ABC transporter, ATP-binding/permease protein	->->	2534213	2534321	109	20.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
675	TDE2514	serine/threonine protein phosphatase family protein	TDE2515	hypothetical protein	<-<-	2540623	2541061	439	41%	0	0	1	+: 0/4/0 \| -: 0/3/0	1	0	0	0	Result
676	TDE2516	hypothetical protein	TDE2517	DNA repair protein RadA	-><-	2542254	2542543	290	45.2%	0	0	0	+: 0/2/0 \| -: 0/2/0	2	0	0	0	Result
677	TDE2518	nucleotide-binding protein	TDE2519	hypothetical protein	<-<-	2544796	2544928	133	24.1%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
678	TDE2520	hypothetical protein	TDE2521	hypothetical protein	<-<-	2547889	2548044	156	25%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
681	TDE2529	hypothetical protein	TDE2530	radical SAM domain protein	<-->	2557329	2557501	173	28.9%	0	0	0	+: 0/0/0 \| -: 2/1/0	1	0	0	0	Result
682	TDE2534	endonuclease III	TDE2535	pyruvate kinase	->->	2560917	2561031	115	32.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
683	TDE2540	lipoprotein, putative	TDE2541	hypothetical protein	<-->	2568072	2568304	233	33%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
684	TDE2541	hypothetical protein	TDE2542	antigen, putative	-><-	2569250	2569530	281	43.1%	0	0	0	+: 0/3/0 \| -: 0/2/0	1	0	0	0	Result
685	TDE2544	hypothetical protein	TDE2545	hypothetical protein	<-<-	2571127	2571259	133	33.1%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
686	TDE2546	hypothetical protein	TDE2547	hypothetical protein	<-->	2572852	2573016	165	31.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
687	TDE2548	hypothetical protein	TDE2549	methyl-accepting chemotaxis protein	<-->	2573289	2573424	136	33.1%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
688	TDE2552	ABC transporter, ATP-binding/permease protein	TDE2553	lysyl-tRNA synthetase	<-<-	2579035	2579136	102	38.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
689	TDE2553	lysyl-tRNA synthetase	TDE2554	chaperonin, 33 kDa family	<-->	2580724	2580884	161	31.7%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
690	TDE2557	hypothetical protein	TDE2558	ABC transporter, ATP-binding/permease protein	<-<-	2583474	2583818	345	33%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
693	TDE2572	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	TDE2573	glucose-6-phosphate isomerase	<-->	2598829	2598941	113	30.1%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
694	TDE2578	hypothetical protein	TDE2579	ATP-dependent DNA helicase RecG	<-<-	2603245	2603377	133	29.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
695	TDE2579	ATP-dependent DNA helicase RecG	TDE2580	GGDEF domain protein	<-->	2605415	2605585	171	27.5%	0	0	0	+: 3/0/0 \| -: 1/0/0	1	0	0	0	Result
696	TDE2581	hypothetical protein	TDE2582	GGDEF domain protein	->->	2611693	2611928	236	23.3%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
697	TDE2586	DNA polymerase III subunits gamma and tau	TDE2587	endonuclease/exonuclease/phosphatase family protein	<-->	2622180	2622330	151	23.8%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
699	TDE2588	integrase domain protein	TDE2589	putative aminopeptidase 1	-><-	2624839	2625089	251	33.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
701	TDE2606	urocanate hydratase	TDE2607	hypothetical protein	->->	2648612	2648725	114	43.9%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
702	TDE2613	hypothetical protein	TDE2614	ApbE family protein	-><-	2655917	2656107	191	26.2%	0	0	0	+: 1/2/0 \| -: 1/0/0	1	0	0	0	Result
703	TDE2626	ABC transporter, ATP-binding/permease protein	TDE2627	transcriptional regulator, TetR family	<-<-	2668493	2668621	129	32.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
705	TDE2637	hypothetical protein	TDE2638	hypothetical protein	<-->	2677407	2677632	226	31%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
706	TDE2650	transcriptional regulator, putative	TDE2651	ABC transporter, ATP-binding protein	<-->	2689122	2689288	167	23.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
708	TDE2671	hypothetical protein	TDE2672	TPR domain protein	<-->	2710183	2710349	167	26.9%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
709	TDE2674	hypothetical protein	TDE2675	hypothetical protein	<-->	2713368	2713513	146	24%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
710	TDE2678	alpha-amylase family protein	TDE2679	hypothetical protein	<-->	2719481	2719657	177	35%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
711	TDE2691	hypothetical protein	TDE2692	CTP synthetase	->->	2729407	2729560	154	38.3%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
713	TDE2696	TPR domain protein	TDE2697	3-oxo-5-alpha-steroid 4-dehydrogenase family protein	<-->	2740127	2740399	273	35.5%	0	0	0	+: 3/0/0 \| -: 1/1/1	1	0	0	0	Result
715	TDE2706	hypothetical protein	TDE2707	hypothetical protein	<-->	2753884	2754086	203	21.7%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
716	TDE2707	hypothetical protein	TDE2708	hypothetical protein	-><-	2754990	2755225	236	40.7%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
717	TDE2708	hypothetical protein	TDE2709	BNR domain protein	<-<-	2761589	2761783	195	34.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
718	TDE2709	BNR domain protein	TDE2710	MATE efflux family protein	<-->	2766449	2766669	221	21.3%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
719	TDE2710	MATE efflux family protein	TDE2711	hypothetical protein	->->	2768035	2768151	117	18.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
720	TDE2713	RNA methyltransferase, TrmH family	TDE2714	hypothetical protein	<-<-	2770415	2770716	302	47.4%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
721	TDE2715	hypothetical protein	TDE2716	HAD-superfamily hydrolase, subfamily IA	->->	2772997	2773334	338	35.8%	0	1	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
722	TDE2718	magnesium transporter	TDE2719	hypothetical protein	<-->	2776001	2776184	184	28.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
723	TDE2727	GTPase YjeQ, putative	TDE2728	hypothetical protein	<-->	2785436	2785746	311	29.6%	0	0	0	+: 0/0/0 \| -: 2/1/0	1	0	0	0	Result
724	TDE2729	hypothetical protein	TDE2730	hydrolase, TatD family	<-->	2786548	2786725	178	24.2%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
725	TDE2734	hypothetical protein	TDE2735	surface antigen, putative	->->	2789922	2790293	372	49.7%	0	0	0	+: 0/1/0 \| -: 0/4/0	1	0	0	0	Result
726	TDE2735	surface antigen, putative	TDE2736	hypothetical protein	-><-	2791677	2791791	115	54.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
728	TDE2737	hypothetical protein	TDE2738	oligoendopeptidase F, putative	->->	2792751	2792902	152	43.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
729	TDE2738	oligoendopeptidase F, putative	TDE2739	hypothetical protein	->->	2794634	2794812	179	37.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
730	TDE2739	hypothetical protein	TDE2740	type I restriction-modification system, S subunit, truncation	->->	2795230	2795341	112	37.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
731	TDE2740	type I restriction-modification system, S subunit, truncation	TDE2741	hypothetical protein	->->	2795831	2796002	172	29.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
732	TDE2741	hypothetical protein	TDE2742	site-specific recombinase, phage integrase family	-><-	2796783	2796939	157	36.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
733	TDE2747	type I restriction-modification system, R subunit	TDE2748	acetyltransferase, GNAT family	<-->	2805033	2805247	215	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
735	TDE2752	hypothetical protein	TDE2753	LysM domain/M23/M37 peptidase domain protein	-><-	2809531	2809647	117	40.2%	0	0	0	+: 1/2/0 \| -: 0/0/0	1	0	0	0	Result
736	TDE2753	LysM domain/M23/M37 peptidase domain protein	TDE2754	ornithine cyclodeaminase	<-<-	2810740	2810850	111	26.1%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
737	TDE2756	bacterial extracellular solute-binding protein, family 5	TDE2757	nucleotidyltransferase family protein	<-->	2813608	2813812	205	29.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
738	TDE2770	flagellar hook-length control protein FliK	TDE2771	hypothetical protein	<-->	2824508	2824858	351	28.8%	0	0	1	+: 0/3/0 \| -: 0/4/0	1	0	0	0	Result
739	TDE2775	lipoprotein, putative	TDE2776	proline iminopeptidase	->->	2827191	2827503	313	31.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
740	TDE2782	ABC transporter, ATP-binding/permease protein	TDE2783	methyl-accepting chemotaxis protein	<-->	2834367	2834549	183	20.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
Total:										0	10	0/45		642	1